CRISPR

CRISPR1-pxna

ID
ZDB-CRISPR-170609-10
Name
CRISPR1-pxna
Previous Names
None
Target
Sequence
5' - GGAGGGGAGATTACTCGAGGCGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sny6300 pxna
sny6400 pxna
sny6500 pxna
Expression
Gene expression in Wild Types + CRISPR1-pxna
No data available
Phenotype
Phenotype resulting from CRISPR1-pxna
No data available
Phenotype of all Fish created by or utilizing CRISPR1-pxna
Phenotype Fish Conditions Figures
myotome malformed, abnormal pxnasny6500/sny6500 standard conditions Fig. 4 with image from Jacob et al., 2017
myotome development decreased process quality, abnormal pxnasny6500/sny6500 standard conditions Fig. 4 with image from Jacob et al., 2017
whole organism pxna expression absent, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 2 with image from Jacob et al., 2017
myotome muscle tendon junction ab1-lama1 labeling decreased amount, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 5 with image from Jacob et al., 2017
myotome muscle cell increased length, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 4 with image from Jacob et al., 2017
myotome muscle tendon junction ab2-fn labeling increased distribution, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 5 with image from Jacob et al., 2017
notochord outer sheath cell cell-cell junction ab1-tjp1 labeling mislocalised, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 3 with image from Jacob et al., 2017
cardiac ventricle decreased volume, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 3 with image from Jacob et al., 2017
post-vent region notochord kinked, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 2 with image from Jacob et al., 2017
brain edematous, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 3 with image from Jacob et al., 2017
cardiac ventricle decreased size, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 3 with image from Jacob et al., 2017
notochord malformed, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 3 with image from Jacob et al., 2017
whole organism decreased length, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 2 with image from Jacob et al., 2017
myotome malformed, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 4 with image,  Fig. 5 with image from Jacob et al., 2017
heart looping decreased process quality, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 3 with image from Jacob et al., 2017
whole organism pxnb expression absent, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 2 with image from Jacob et al., 2017
heart edematous, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 2 with image,  Fig. 3 with image from Jacob et al., 2017
myotome muscle tendon junction ab2-fn labeling increased amount, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 5 with image from Jacob et al., 2017
heart edematous, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 2 with image,  Fig. 3 with image from Jacob et al., 2017
heart looping decreased process quality, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 3 with image from Jacob et al., 2017
notochord outer sheath cell cytoplasm ab1-tjp1 labeling mislocalised, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 3 with image from Jacob et al., 2017
brain edematous, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 3 with image from Jacob et al., 2017
myotome muscle cell detached from myotome muscle tendon junction, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 4 with image,  Fig. 5 with image from Jacob et al., 2017
myotome development decreased process quality, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 4 with image from Jacob et al., 2017
myotome development decreased process quality, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 4 with image,  Fig. 5 with image from Jacob et al., 2017
vertical myoseptum ab1-lama1 labeling decreased amount, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 5 with image from Jacob et al., 2017
notochord outer sheath cell mislocalised, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 3 with image from Jacob et al., 2017
myotome malformed, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 4 with image from Jacob et al., 2017
heart edematous, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 2 with image from Jacob et al., 2017
atrium decreased volume, abnormal pxnasny6500/sny6500; pxnbsny7100/sny7100 standard conditions Fig. 3 with image from Jacob et al., 2017
Citations