CRISPR

CRISPR1-sema3d

ID
ZDB-CRISPR-170202-1
Name
CRISPR1-sema3d
Previous Names
None
Target
Sequence
5' - GGAGACAGGTCAGGACGGGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mu268 sema3d
Expression
Gene expression in Wild Types + CRISPR1-sema3d
No data available
Phenotype
Phenotype resulting from CRISPR1-sema3d
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sema3d
Phenotype Fish Conditions Figures
venous blood vessel morphogenesis decreased process quality, abnormal sema3dmu268/mu268 ; s843Tg standard conditions Fig. 1 with image from Hamm et al., 2016
common cardinal vein decreased length, abnormal sema3dmu268/mu268 ; s843Tg standard conditions Fig. 1 with image from Hamm et al., 2016
common cardinal vein increased width, abnormal sema3dmu268/mu268 ; s843Tg standard conditions Fig. 1 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell migration decreased process quality, abnormal sema3dmu268/mu268 ; s843Tg standard conditions Fig. 1 with image from Hamm et al., 2016
venous blood vessel morphogenesis decreased process quality, abnormal sema3dmu268/mu268; mu240Tg standard conditions Fig. 1 with imageFig. 8 with image from Hamm et al., 2016
common cardinal vein actin filament bundle organization decreased process quality, abnormal sema3dmu268/mu268; mu240Tg standard conditions Fig. 5 with imageFig. 8 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell structure, cavities, abnormal sema3dmu268/mu268; mu240Tg standard conditions Fig. 8 with image from Hamm et al., 2016
common cardinal vein actin filament bundle disoriented, abnormal sema3dmu268/mu268; mu240Tg standard conditions Fig. 5 with imageFig. 8 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell shape, abnormal sema3dmu268/mu268; mu240Tg standard conditions Fig. 5 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelium patchy, abnormal sema3dmu268/mu268; mu240Tg standard conditions Fig. 5 with image from Hamm et al., 2016
common cardinal vein cell-cell junction decreased length, abnormal sema3dmu268/mu268; mu240Tg standard conditions Fig. 5 with imageFig. 8 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell disorganized, abnormal sema3dmu268/mu268; mu240Tg standard conditions Fig. 1 with image from Hamm et al., 2016
Citations