CRISPR

CRISPR1-kif5ba

ID
ZDB-CRISPR-151218-3
Name
CRISPR1-kif5ba
Previous Names
None
Target
Sequence
5' - GGACAGGATAGCGTCGTGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ae11 kif5ba
ae12 kif5ba
Expression
Gene expression in Wild Types + CRISPR1-kif5ba
No data available
Phenotype
Phenotype resulting from CRISPR1-kif5ba
No data available
Phenotype of all Fish created by or utilizing CRISPR1-kif5ba
Phenotype Fish Conditions Figures
whole organism lacks all parts of type notochord, abnormal kif5baae11/ae11 (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
whole organism wholly ventralized, abnormal kif5baae11/ae11 (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
somite cuboid, abnormal kif5baae11/ae11 (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
germ cell development decreased process quality, abnormal kif5baae11/ae11 (AB) standard conditions Fig. 2 with image from Campbell et al., 2015
blastomere cleavage furrow ddx4 expression absent, abnormal kif5baae11/ae11 (AB) standard conditions Fig. 2 with image from Campbell et al., 2015
blastomere cleavage furrow nanos3 expression absent, abnormal kif5baae11/ae11 (AB) standard conditions Fig. 2 with image from Campbell et al., 2015
head decreased size, abnormal kif5baae11/ae11 (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
dorsal/ventral pattern formation decreased process quality, abnormal kif5baae11/ae11 (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
chondrocyte endoplasmic reticulum position, abnormal kif5baae12/ae12 standard conditions Fig. 2 with image from Santos-Ledo et al., 2017
mandibular arch skeleton protruding, abnormal kif5baae12/ae12 standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
chondrocyte extracellular matrix ab1-col2a labeling spatial pattern, abnormal kif5baae12/ae12 standard conditions Fig. 2 with image from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal kif5baae12/ae12 standard conditions Fig. 2 with image from Santos-Ledo et al., 2017
chondrocyte mitochondrion position, abnormal kif5baae12/ae12 standard conditions Fig. 2 with image from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal kif5baae12/ae12 standard conditions Fig. 2 with image from Santos-Ledo et al., 2017
head flattened, abnormal kif5baae12/ae12 standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
testis lacks all parts of type germ line cell, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 2 with image from Campbell et al., 2015
unfertilized egg posterior region sybu expression increased distribution, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 6 with image from Campbell et al., 2015
whole organism lacks all parts of type primordial germ cell, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 2 with image from Campbell et al., 2015
unfertilized egg posterior region has extra parts of type unfertilized egg cortical granule, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 7 with image from Campbell et al., 2015
germ cell development decreased process quality, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 2 with image from Campbell et al., 2015
whole organism wholly ventralized, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
egg activation decreased process quality, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 6 with image from Campbell et al., 2015
somite cuboid, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
unfertilized egg sybu expression increased amount, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 6 with image from Campbell et al., 2015
blastomere cleavage furrow ddx4 expression absent, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 2 with image from Campbell et al., 2015
unfertilized egg microtubule disorganized, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 7 with image from Campbell et al., 2015
head decreased size, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
dorsal/ventral pattern formation decreased process quality, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
whole organism lacks all parts of type notochord, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
unfertilized egg posterior region sybu expression increased amount, abnormal kif5baae12/ae12 (AB) standard conditions Fig. 6 with image from Campbell et al., 2015
testis lacks all parts of type germ line cell, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 2 with image from Campbell et al., 2015
unfertilized egg posterior region sybu expression increased distribution, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 6 with image from Campbell et al., 2015
germ cell development decreased process quality, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 2 with image from Campbell et al., 2015
unfertilized egg posterior region wnt8a expression mislocalised, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 6 with image from Campbell et al., 2015
whole organism wholly ventralized, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
egg activation decreased process quality, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 6 with image from Campbell et al., 2015
somite cuboid, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
blastomere cleavage furrow ddx4 expression absent, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 2 with image from Campbell et al., 2015
blastomere cleavage furrow nanos3 expression absent, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 2 with image from Campbell et al., 2015
head decreased size, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
dorsal/ventral pattern formation decreased process quality, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
whole organism lacks all parts of type notochord, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 5 with image from Campbell et al., 2015
unfertilized egg posterior region sybu expression increased amount, abnormal kif5baae11/+; kif5baae12/+ (AB) standard conditions Fig. 6 with image from Campbell et al., 2015
chondrocyte secretion decreased occurrence, abnormal kif5baae12/ae12; ba2Tg standard conditions Fig. 2 with image from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte morphology, abnormal kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
Meckel's cartilage shortened, abnormal kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
Meckel's cartilage curved, abnormal kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
trunk skeletal muscle cell broken, abnormal kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. S1 with image from Santos-Ledo et al., 2017
caudal fin skeletal muscle cell broken, abnormal kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. S1 with image from Santos-Ledo et al., 2017
palatoquadrate cartilage shortened, abnormal kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
ceratohyal cartilage shortened, abnormal kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
mandibular arch skeleton protruding, exacerbated kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
head flattened, abnormal kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
extraocular musculature M band morphology, abnormal kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. S1 with image from Santos-Ledo et al., 2017
ceratohyal cartilage curved, abnormal kif5baae12/ae12 ; kif5bbae24/+ standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
chondrocyte endoplasmic reticulum position, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 2 with image from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte morphology, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
chondrocyte extracellular matrix ab1-col2a labeling spatial pattern, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 2 with image from Santos-Ledo et al., 2017
whole organism Ab3-mtor labeling decreased amount, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 5 with image from Santos-Ledo et al., 2017
whole organism ab3-map1lc3b labeling increased amount, abnormal kif5baae12/ae12; kif5bbae24/ae24 control Fig. 5 with image from Santos-Ledo et al., 2017
TOR signaling decreased occurrence, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 5 with image from Santos-Ledo et al., 2017
chondrocyte degenerate, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 5 with image from Santos-Ledo et al., 2017
chondrocyte vacuole increased amount, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 5 with image from Santos-Ledo et al., 2017
chondrocyte ab3-map1lc3b labeling increased amount, abnormal kif5baae12/ae12; kif5bbae24/ae24 chemical treatment by environment: ammonium chloride Fig. 5 with image from Santos-Ledo et al., 2017
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
palatoquadrate cartilage chondrocyte position, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
Meckel's cartilage shortened, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
Meckel's cartilage curved, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
perichondral bone autophagy occurrence, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 5 with image from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 1 with imageFig. 2 with image from Santos-Ledo et al., 2017
chondrocyte rough endoplasmic reticulum distended, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 5 with image from Santos-Ledo et al., 2017
trunk skeletal muscle cell broken, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. S1 with image from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 2 with image from Santos-Ledo et al., 2017
chondrocyte mitochondrion position, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 2 with image from Santos-Ledo et al., 2017
caudal fin skeletal muscle cell broken, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. S1 with image from Santos-Ledo et al., 2017
palatoquadrate cartilage shortened, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
perichondrium disorganized, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 5 with image from Santos-Ledo et al., 2017
whole organism ab3-map1lc3b labeling increased amount, abnormal kif5baae12/ae12; kif5bbae24/ae24 chemical treatment by environment: ammonium chloride Fig. 5 with image from Santos-Ledo et al., 2017
ceratohyal cartilage shortened, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
mandibular arch skeleton protruding, exacerbated kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
palatoquadrate cartilage chondrocyte circular, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
head flattened, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
extraocular musculature M band morphology, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. S1 with image from Santos-Ledo et al., 2017
chondrocyte ab3-map1lc3b labeling increased amount, abnormal kif5baae12/ae12; kif5bbae24/ae24 control Fig. 5 with image from Santos-Ledo et al., 2017
ceratohyal cartilage curved, abnormal kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 1 with image from Santos-Ledo et al., 2017
perichondral bone bone mineralization decreased occurrence, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 3 with image from Santos-Ledo et al., 2017
entopterygoid decreased size, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 3 with image from Santos-Ledo et al., 2017
chondrocyte centrosome polarity, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
perichondral bone autophagy occurrence, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 5 with image from Santos-Ledo et al., 2017
dentary decreased size, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 3 with image from Santos-Ledo et al., 2017
branchiostegal ray decreased size, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 3 with image from Santos-Ledo et al., 2017
chondrocyte lysosome increased size, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 5 with image from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 2 with image from Santos-Ledo et al., 2017
endochondral bone bone mineralization decreased occurrence, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 3 with image from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 2 with image from Santos-Ledo et al., 2017
chondrocyte centrosome position, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
chondrocyte ab8-rps6 labeling decreased amount, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 5 with image from Santos-Ledo et al., 2017
ceratohyal cartilage apoptotic process increased occurrence, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 5 with image from Santos-Ledo et al., 2017
chondrocyte apoptotic process increased occurrence, abnormal kif5baae12/ae12; kif5bbae24/ae24; ba2Tg standard conditions Fig. 5 with image from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte morphology, abnormal gpc4fr6/fr6; kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
chondrocyte extracellular matrix ab1-col2a labeling spatial pattern, abnormal gpc4fr6/fr6; kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
mandibular arch skeleton decreased size, abnormal gpc4fr6/fr6; kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal gpc4fr6/fr6; kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal gpc4fr6/fr6; kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte morphology, abnormal wnt5bta98/ta98; kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
chondrocyte extracellular matrix ab1-col2a labeling spatial pattern, abnormal wnt5bta98/ta98; kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
mandibular arch skeleton decreased size, abnormal wnt5bta98/ta98; kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal wnt5bta98/ta98; kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal wnt5bta98/ta98; kif5baae12/ae12; kif5bbae24/ae24 standard conditions Fig. 4 with image from Santos-Ledo et al., 2017
Citations