CRISPR

CRISPR2-stra6l

ID

ZDB-CRISPR-201116-8

Name

CRISPR2-stra6l

Previous Names

None

Target

stra6l (1)

Sequence

5' - TTGACAAACTGGACTCTTTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
muz200	stra6l
muz98	stra6l
muz99	stra6l

Expression

Gene expression in Wild Types + CRISPR2-stra6l

No data available

Phenotype

Phenotype resulting from CRISPR2-stra6l

No data available

Phenotype of all Fish created by or utilizing CRISPR2-stra6l

Phenotype	Fish	Conditions	Figures
eye decreased size, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. S7 from Solanki et al., 2020
head lrata expression decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. S10 from Solanki et al., 2020
head all-trans-retinol decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
head dhrs3a expression decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. S10 from Solanki et al., 2020
eye lrata expression decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
eye dhrs3a expression decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
head retinyl ester decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
retina rod photoreceptor outer segment decreased length, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. 6, Fig. 7, Fig. S8 from Solanki et al., 2020
head aldh1a2 expression decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. S10 from Solanki et al., 2020
head 11-cis-retinal decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
head stra6 expression decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. S10 from Solanki et al., 2020
eye stra6 expression decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
retina photoreceptor outer segment decreased length, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. S7 from Solanki et al., 2020
eye cyp26a1 expression decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
head cyp26a1 expression decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. S10 from Solanki et al., 2020
eye aldh1a2 expression decreased amount, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
retina cone photoreceptor outer segment decreased length, abnormal	stra6l^muz99/muz99; fl1Tg/+	standard conditions	Fig. S8, Fig. S9 from Solanki et al., 2020
retina photoreceptor outer segment length, ameliorated	stra6l^muz99/muz99; ucd1Tg/+	chemical treatment by environment: all-trans-retinoic acid	Fig. S11 from Solanki et al., 2020
eye decreased size, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. 5, Fig. S6 from Solanki et al., 2020
head lrata expression decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. S10 from Solanki et al., 2020
retina apoptotic process increased occurrence, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. 9, Fig. S15 from Solanki et al., 2020
retinal photoreceptor layer decreased thickness, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. 5, Fig. S6 from Solanki et al., 2020
eye lrata expression decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
head all-trans-retinol decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
head dhrs3a expression decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. S10 from Solanki et al., 2020
head retinyl ester decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
eye dhrs3a expression decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
eye size, ameliorated	stra6l^muz99/muz99; ucd1Tg/+	chemical treatment by environment: all-trans-retinoic acid	Fig. S11 from Solanki et al., 2020
head 11-cis-retinal decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
head stra6 expression decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. S10 from Solanki et al., 2020
eye stra6 expression decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
photoreceptor cell maintenance disrupted, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. S15 from Solanki et al., 2020
retina photoreceptor outer segment decreased length, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. S6 from Solanki et al., 2020
retina cone photoreceptor outer segment decreased length, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. 6, Fig. 7, Fig. S9 from Solanki et al., 2020
eye cyp26a1 expression decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
head cyp26a1 expression decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. S10 from Solanki et al., 2020
eye aldh1a2 expression decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. 8 from Solanki et al., 2020
head aldh1a2 expression decreased amount, abnormal	stra6l^muz99/muz99; ucd1Tg/+	standard conditions	Fig. S10 from Solanki et al., 2020

Citations