Morpholino

MO2-rnf213a

ID
ZDB-MRPHLNO-110822-12
Name
MO2-rnf213a
Previous Names
  • RNF213-alpha-MO1-D (1)
Target
Sequence
5' - AGCTAGGAGAAAGTCCTACCAATTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rnf213a
Expressed Gene Anatomy Figures
rnf213a Fig. 1 with image from Kotani et al., 2015
Phenotype
Phenotype resulting from MO2-rnf213a
Phenotype Fish Figures
CaP motoneuron axon extension involved in axon guidance decreased process quality, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a Fig. 2 with image,  Fig. 4 with image from Kotani et al., 2015
fast muscle cell has fewer parts of type fast muscle cell skeletal muscle myofibril, abnormal WT + MO2-rnf213a Fig. 3 with image,  Fig. 4 with image from Kotani et al., 2015
fast muscle cell skeletal muscle fiber development decreased process quality, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a Fig. 3 with image,  Fig. 4 with image from Kotani et al., 2015
fast muscle cell Z disc increased thickness, abnormal WT + MO2-rnf213a Fig. 3 with image,  Fig. 4 with image from Kotani et al., 2015
hatching decreased occurrence, abnormal WT + MO2-rnf213a Fig. 1 with image from Kotani et al., 2015
head lipid droplet decreased amount, abnormal WT + MO2-rnf213a Fig. S2 from Sugihara et al., 2019
MiP motor neuron axon extension involved in axon guidance decreased process quality, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a Fig. 2 with image,  Fig. 4 with image from Kotani et al., 2015
muscle pioneer skeletal muscle cell differentiation process quality, abnormal WT + MO2-rnf213a Fig. 5 with image from Kotani et al., 2015
myotome has extra parts of type muscle pioneer, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a Fig. 5 with image from Kotani et al., 2015
myotome fast muscle cell loose, abnormal WT + MO2-rnf213a Fig. 3 with image,  Fig. 4 with image from Kotani et al., 2015
RoP motor neuron axon extension involved in axon guidance decreased process quality, abnormal WT + MO2-rnf213a Fig. 2 with image,  Fig. 4 with image from Kotani et al., 2015
swimming decreased rate, abnormal WT + MO2-rnf213a Fig. 1 with image from Kotani et al., 2015
whole organism rnf213a expression decreased amount, abnormal WT + MO2-rnf213a Fig. 1 with image from Kotani et al., 2015
Phenotype of all Fish created by or utilizing MO2-rnf213a
Phenotype Fish Conditions Figures
fast muscle cell Z disc increased thickness, abnormal WT + MO2-rnf213a standard conditions Fig. 3 with image from Kotani et al., 2015
fast muscle cell has fewer parts of type fast muscle cell skeletal muscle myofibril, abnormal WT + MO2-rnf213a standard conditions Fig. 3 with image from Kotani et al., 2015
head lipid droplet amount, ameliorated WT + MO2-rnf213a chemical treatment: orlistat Fig. S2 from Sugihara et al., 2019
muscle pioneer skeletal muscle cell differentiation process quality, abnormal WT + MO2-rnf213a standard conditions Fig. 5 with image from Kotani et al., 2015
fast muscle cell skeletal muscle fiber development decreased process quality, abnormal WT + MO2-rnf213a standard conditions Fig. 3 with image from Kotani et al., 2015
MiP motor neuron axon extension involved in axon guidance decreased process quality, abnormal WT + MO2-rnf213a standard conditions Fig. 2 with image from Kotani et al., 2015
head lipid droplet decreased amount, abnormal WT + MO2-rnf213a standard conditions Fig. S2 from Sugihara et al., 2019
swimming decreased rate, abnormal WT + MO2-rnf213a standard conditions Fig. 1 with image from Kotani et al., 2015
RoP motor neuron axon extension involved in axon guidance decreased process quality, abnormal WT + MO2-rnf213a standard conditions Fig. 2 with image from Kotani et al., 2015
myotome has extra parts of type muscle pioneer, abnormal WT + MO2-rnf213a standard conditions Fig. 5 with image from Kotani et al., 2015
whole organism rnf213a expression decreased amount, abnormal WT + MO2-rnf213a standard conditions Fig. 1 with image from Kotani et al., 2015
myotome fast muscle cell loose, abnormal WT + MO2-rnf213a standard conditions Fig. 3 with image from Kotani et al., 2015
hatching decreased occurrence, abnormal WT + MO2-rnf213a standard conditions Fig. 1 with image from Kotani et al., 2015
CaP motoneuron axon extension involved in axon guidance decreased process quality, abnormal WT + MO2-rnf213a standard conditions Fig. 2 with image from Kotani et al., 2015
cranial blood vessel increased branchiness, abnormal y1Tg + MO1-rnf213a + MO2-rnf213a standard conditions Fig. 9 with image from Liu et al., 2011
post-vent vasculature increased branchiness, abnormal y1Tg + MO1-rnf213a + MO2-rnf213a standard conditions Fig. 9 with image from Liu et al., 2011
inner optic circle blood vessel increased branchiness, abnormal y1Tg + MO1-rnf213a + MO2-rnf213a standard conditions Fig. 9 with image,  Fig. S11 with image from Liu et al., 2011
sprouting angiogenesis process quality, abnormal y1Tg + MO1-rnf213a + MO2-rnf213a standard conditions Fig. 9 with image from Liu et al., 2011
fast muscle cell Z disc increased thickness, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a control Fig. 4 with image from Kotani et al., 2015
fast muscle cell has fewer parts of type fast muscle cell skeletal muscle myofibril, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a control Fig. 4 with image from Kotani et al., 2015
MiP motor neuron axon extension involved in axon guidance decreased process quality, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a control Fig. 4 with image from Kotani et al., 2015
myotome fast muscle cell loose, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a control Fig. 4 with image from Kotani et al., 2015
fast muscle cell skeletal muscle fiber development decreased process quality, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a control Fig. 4 with image from Kotani et al., 2015
muscle pioneer skeletal muscle cell differentiation process quality, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a control Fig. 5 with image from Kotani et al., 2015
RoP motor neuron axon extension involved in axon guidance decreased process quality, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a control Fig. 4 with image from Kotani et al., 2015
myotome has extra parts of type muscle pioneer, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a control Fig. 5 with image from Kotani et al., 2015
CaP motoneuron axon extension involved in axon guidance decreased process quality, abnormal nkgSA2AzGFF598AGt; nkuasrfp1aTg + MO2-rnf213a control Fig. 4 with image from Kotani et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.