Morpholino

MO1-prpf31

ID
ZDB-MRPHLNO-110124-2
Name
MO1-prpf31
Previous Names
  • CAAGCAGCTCGTCTGCCAAAGACAT (1)
Target
Sequence
5' - CAAGCAGCTCGTCTGCCAAAGACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prpf31
Expressed Gene Anatomy Figures
crx Fig. 4 from Linder et al., 2011
gnat1 Fig. 4 from Linder et al., 2011
gnat2 Fig. 4 from Linder et al., 2011
irx6a Fig. 4 from Linder et al., 2011
lsm7 Fig. 4 from Linder et al., 2011
myf5 Fig. 3 from Linder et al., 2011
myod1 Fig. 3 from Linder et al., 2011
opn1lw1 Fig. 4 from Linder et al., 2011
opn1lw2 Fig. 4 from Linder et al., 2011
opn1mw1 Fig. 4 from Linder et al., 2011
pax2a Fig. 3 from Linder et al., 2011
pcna Fig. 3 from Linder et al., 2011
prpf31 Fig. 3 with image from Yin et al., 2011
rcvrn2 Fig. 4 from Linder et al., 2011
rho Fig. 3,  Fig. 4 from Linder et al., 2011
rx3 Fig. 4 from Linder et al., 2011
Phenotype
Phenotype resulting from MO1-prpf31
Phenotype Fish Figures
brain decreased size, abnormal WT + MO1-prpf31 Fig. 3 with image from Yin et al., 2011
eye opn1lw2 expression decreased amount, abnormal WT + MO1-prpf31 Fig. 4 from Linder et al., 2011
eye rcvrn2 expression decreased amount, abnormal WT + MO1-prpf31 Fig. 4 from Linder et al., 2011
eye gnat1 expression decreased amount, abnormal WT + MO1-prpf31 Fig. 4 from Linder et al., 2011
eye decreased size, abnormal WT + MO1-prpf31 Fig. 3 with image from Yin et al., 2011
heart edematous, abnormal WT + MO1-prpf31 Fig. 3 with image from Yin et al., 2011
optokinetic behavior disrupted, abnormal WT + MO1-prpf31 Fig. 2 from Linder et al., 2011
photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-prpf31 Fig. 3 from Linder et al., 2011
post-vent region curved, abnormal WT + MO1-prpf31 Fig. 3 with image from Yin et al., 2011
whole organism dead, abnormal WT + MO1-prpf31 Fig. 1 from Linder et al., 2011
whole organism gnat2 expression decreased amount, abnormal WT + MO1-prpf31 Fig. 4 from Linder et al., 2011
whole organism opn1lw1 expression decreased amount, abnormal WT + MO1-prpf31 Fig. 4 from Linder et al., 2011
whole organism opn1mw1 expression decreased amount, abnormal WT + MO1-prpf31 Fig. 4 from Linder et al., 2011
whole organism crx expression decreased amount, abnormal WT + MO1-prpf31 Fig. 4 from Linder et al., 2011
whole organism rho expression decreased amount, abnormal WT + MO1-prpf31 Fig. 4 from Linder et al., 2011
whole organism rx3 expression decreased amount, abnormal WT + MO1-prpf31 Fig. 4 from Linder et al., 2011
whole organism irx6a expression decreased amount, abnormal WT + MO1-prpf31 Fig. 4 from Linder et al., 2011
whole organism deformed, abnormal WT + MO1-prpf31 Fig. 1 from Linder et al., 2011
whole organism lsm7 expression increased amount, abnormal WT + MO1-prpf31 Fig. 4 from Linder et al., 2011
Phenotype of all Fish created by or utilizing MO1-prpf31
Phenotype Fish Conditions Figures
whole organism rho expression decreased amount, abnormal WT + MO1-prpf31 standard conditions Fig. 4 from Linder et al., 2011
whole organism dead, abnormal WT + MO1-prpf31 standard conditions Fig. 1 from Linder et al., 2011
brain decreased size, abnormal WT + MO1-prpf31 standard conditions Fig. 3 with image from Yin et al., 2011
eye opn1lw2 expression decreased amount, abnormal WT + MO1-prpf31 standard conditions Fig. 4 from Linder et al., 2011
whole organism opn1lw1 expression decreased amount, abnormal WT + MO1-prpf31 standard conditions Fig. 4 from Linder et al., 2011
eye decreased size, abnormal WT + MO1-prpf31 standard conditions Fig. 3 with image from Yin et al., 2011
whole organism opn1mw1 expression decreased amount, abnormal WT + MO1-prpf31 standard conditions Fig. 4 from Linder et al., 2011
optokinetic behavior disrupted, abnormal WT + MO1-prpf31 standard conditions Fig. 2 from Linder et al., 2011
whole organism crx expression decreased amount, abnormal WT + MO1-prpf31 standard conditions Fig. 4 from Linder et al., 2011
heart edematous, abnormal WT + MO1-prpf31 standard conditions Fig. 3 with image from Yin et al., 2011
whole organism lsm7 expression increased amount, abnormal WT + MO1-prpf31 standard conditions Fig. 4 from Linder et al., 2011
whole organism deformed, abnormal WT + MO1-prpf31 standard conditions Fig. 1 from Linder et al., 2011
whole organism rx3 expression decreased amount, abnormal WT + MO1-prpf31 standard conditions Fig. 4 from Linder et al., 2011
eye gnat1 expression decreased amount, abnormal WT + MO1-prpf31 standard conditions Fig. 4 from Linder et al., 2011
post-vent region curved, abnormal WT + MO1-prpf31 standard conditions Fig. 3 with image from Yin et al., 2011
eye rcvrn2 expression decreased amount, abnormal WT + MO1-prpf31 standard conditions Fig. 4 from Linder et al., 2011
photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-prpf31 standard conditions Fig. 3 from Linder et al., 2011
whole organism irx6a expression decreased amount, abnormal WT + MO1-prpf31 standard conditions Fig. 4 from Linder et al., 2011
whole organism gnat2 expression decreased amount, abnormal WT + MO1-prpf31 standard conditions Fig. 4 from Linder et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.