Morpholino

MO1-ahr2

ID
ZDB-MRPHLNO-050604-1
Name
MO1-ahr2
Previous Names
  • MO2-ahr2
Target
Sequence
5' - TGTACCGATACCCGCCGACATGGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This morpholino is the same morpholino reported by Hill et al. 2004 and Prasch et al. 2003. The sequence published by Prasch et al. and Hill et al. contained typos. The sequence is correct as displayed here confirmed by author.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ahr2
Phenotype
Phenotype resulting from MO1-ahr2
No data available
Phenotype of all Fish created by or utilizing MO1-ahr2
Phenotype Fish Conditions Figures
ceratobranchial cartilage morphology, abnormal AB + MO1-ahr2 chemical treatment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 5 from Yin et al., 2008
Meckel's cartilage decreased length, abnormal AB + MO1-ahr2 chemical treatment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 5 from Yin et al., 2008
Meckel's cartilage increased angle to ethmoid cartilage, abnormal AB + MO1-ahr2 chemical treatment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 5 from Yin et al., 2008
pericardium edematous, abnormal AB + MO1-ahr2 chemical treatment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 5 from Yin et al., 2008
pericardium morphology, ameliorated EKW + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 8 from Garner et al., 2013
pericardium morphology, ameliorated EKW + MO1-ahr2 chemical treatment by environment: Benzo[k]fluoranthene, chemical treatment by environment: fluoranthene Fig. 7 from Garner et al., 2013
pericardium morphology, ameliorated EKW + MO1-ahr2 chemical treatment by environment: benzo[a]pyrene, chemical treatment by environment: fluoranthene Fig. 7 from Garner et al., 2013
whole organism cyp1a expression amount, ameliorated TL + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 5 from Kubota et al., 2015
whole organism cyp3c1 expression amount, ameliorated TL + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 5 from Kubota et al., 2015
whole organism cyp2aa12 expression amount, ameliorated TL + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 5 from Kubota et al., 2015
positive regulation of transcription by RNA polymerase II disrupted, abnormal TL + MO1-ahr2 chemical treatment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 3 from Jenny et al., 2009
whole organism nr1i2 expression amount, ameliorated TL + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 5 from Kubota et al., 2015
response to stress disrupted, abnormal TL + MO1-ahr2 chemical treatment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 3 from Jenny et al., 2009
whole organism cyp3a65 expression amount, ameliorated TL + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 5 from Kubota et al., 2015
whole organism ahr2 expression increased amount, abnormal TL + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 5 from Kubota et al., 2015
whole organism cyp1b1 expression amount, ameliorated WT + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. S2 from Ko et al., 2012
pericardium composition, ameliorated WT + MO1-ahr2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 2 from Dong et al., 2019
heart contraction rate, ameliorated WT + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 3 from Ko et al., 2012
whole organism cyp1a expression amount, ameliorated WT + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. S2 from Ko et al., 2012
whole organism cyp1c1 expression amount, ameliorated WT + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. S2 from Ko et al., 2012
heart morphology, ameliorated WT + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 3 from Ko et al., 2012
pericardium morphology, ameliorated EKW + MO1-ahr1a + MO1-ahr2 chemical treatment by environment: benzo[a]pyrene, chemical treatment by environment: fluoranthene Fig. 7 from Garner et al., 2013
pericardium morphology, ameliorated EKW + MO1-ahr1a + MO1-ahr2 chemical treatment by environment: Benzo[k]fluoranthene, chemical treatment by environment: fluoranthene Fig. 7 from Garner et al., 2013
pericardium morphology, ameliorated EKW + MO1-ahr1a + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 8 from Garner et al., 2013
Citations