Morpholino

MO2-jmjd6

ID
ZDB-MRPHLNO-160922-1
Name
MO2-jmjd6
Previous Names
None
Target
Sequence
5' - TCCGTTTCTTGCTTTTATGGTTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-jmjd6
Expressed Gene Anatomy Figures
jmjd6 Fig. 5 from Hong et al., 2004
nkx2.5 Fig. 6 from Hong et al., 2004
pax2a Fig. 6 from Hong et al., 2004
Phenotype
Phenotype resulting from MO2-jmjd6
Phenotype Fish Figures
anatomical structure jmjd6 expression spatial pattern, abnormal WT + MO2-jmjd6 Fig. 5 from Hong et al., 2004
apoptotic cell clearance arrested, abnormal WT + MO2-jmjd6 Fig. 4,  Fig. 5,  Fig. 7 from Hong et al., 2004
atrium aplastic, abnormal WT + MO2-jmjd6 Fig. 6 from Hong et al., 2004
brain decreased size, abnormal WT + MO2-jmjd6 Fig. 5 from Hong et al., 2004
brain pax2a expression spatial pattern, abnormal WT + MO2-jmjd6 Fig. 6 from Hong et al., 2004
cardiac ventricle aplastic, abnormal WT + MO2-jmjd6 Fig. 6 from Hong et al., 2004
embryonic morphogenesis disrupted, abnormal WT + MO2-jmjd6 Fig. 5,  Fig. 7 from Hong et al., 2004
engulfment of apoptotic cell disrupted, abnormal WT + MO2-jmjd6 Fig. 3 from Hong et al., 2004
epiboly arrested, abnormal WT + MO2-jmjd6 Fig. 3 from Hong et al., 2004
hatching disrupted, abnormal WT + MO2-jmjd6 Fig. 5 from Hong et al., 2004
heart structure, cavities, abnormal WT + MO2-jmjd6 Fig. 6 from Hong et al., 2004
heart tubular, abnormal WT + MO2-jmjd6 Fig. 6 from Hong et al., 2004
heart development disrupted, abnormal WT + MO2-jmjd6 Fig. 5,  Fig. 6 from Hong et al., 2004
heart tube nkx2.5 expression absent, abnormal WT + MO2-jmjd6 Fig. 6 from Hong et al., 2004
hindbrain decreased size, abnormal WT + MO2-jmjd6 Fig. 6 from Hong et al., 2004
midbrain decreased size, abnormal WT + MO2-jmjd6 Fig. 6 from Hong et al., 2004
neural tube morphology, abnormal WT + MO2-jmjd6 Fig. 3 from Hong et al., 2004
notochord bent, abnormal WT + MO2-jmjd6 Fig. 5,  Fig. 6 from Hong et al., 2004
somite decreased thickness, abnormal WT + MO2-jmjd6 Fig. 3 from Hong et al., 2004
somite morphology, abnormal WT + MO2-jmjd6 Fig. 3 from Hong et al., 2004
somite apoptotic process increased occurrence, abnormal WT + MO2-jmjd6 Fig. 6 from Hong et al., 2004
somite development disrupted, abnormal WT + MO2-jmjd6 Fig. 5 from Hong et al., 2004
whole organism jmjd6 expression spatial pattern, abnormal WT + MO2-jmjd6 Fig. 5 from Hong et al., 2004
whole organism apoptotic process increased occurrence, abnormal WT + MO2-jmjd6 Fig. 4 from Hong et al., 2004
Phenotype of all Fish created by or utilizing MO2-jmjd6
Phenotype Fish Conditions Figures
atrium aplastic, abnormal WT + MO2-jmjd6 standard conditions Fig. 6 from Hong et al., 2004
engulfment of apoptotic cell disrupted, abnormal WT + MO2-jmjd6 standard conditions Fig. 3 from Hong et al., 2004
somite apoptotic process increased occurrence, abnormal WT + MO2-jmjd6 standard conditions Fig. 6 from Hong et al., 2004
heart tube nkx2.5 expression absent, abnormal WT + MO2-jmjd6 standard conditions Fig. 6 from Hong et al., 2004
epiboly arrested, abnormal WT + MO2-jmjd6 standard conditions Fig. 3 from Hong et al., 2004
brain pax2a expression spatial pattern, abnormal WT + MO2-jmjd6 standard conditions Fig. 6 from Hong et al., 2004
apoptotic cell clearance arrested, abnormal WT + MO2-jmjd6 standard conditions Fig. 4,  Fig. 5,  Fig. 7 from Hong et al., 2004
whole organism jmjd6 expression spatial pattern, abnormal WT + MO2-jmjd6 standard conditions Fig. 5 from Hong et al., 2004
whole organism apoptotic process increased occurrence, abnormal WT + MO2-jmjd6 standard conditions Fig. 4 from Hong et al., 2004
neural tube morphology, abnormal WT + MO2-jmjd6 standard conditions Fig. 3 from Hong et al., 2004
heart structure, cavities, abnormal WT + MO2-jmjd6 standard conditions Fig. 6 from Hong et al., 2004
embryonic morphogenesis disrupted, abnormal WT + MO2-jmjd6 standard conditions Fig. 5,  Fig. 7 from Hong et al., 2004
brain decreased size, abnormal WT + MO2-jmjd6 standard conditions Fig. 5 from Hong et al., 2004
heart tubular, abnormal WT + MO2-jmjd6 standard conditions Fig. 6 from Hong et al., 2004
cardiac ventricle aplastic, abnormal WT + MO2-jmjd6 standard conditions Fig. 6 from Hong et al., 2004
somite morphology, abnormal WT + MO2-jmjd6 standard conditions Fig. 3 from Hong et al., 2004
heart development disrupted, abnormal WT + MO2-jmjd6 standard conditions Fig. 5,  Fig. 6 from Hong et al., 2004
notochord bent, abnormal WT + MO2-jmjd6 standard conditions Fig. 5,  Fig. 6 from Hong et al., 2004
hatching disrupted, abnormal WT + MO2-jmjd6 standard conditions Fig. 5 from Hong et al., 2004
midbrain decreased size, abnormal WT + MO2-jmjd6 standard conditions Fig. 6 from Hong et al., 2004
somite decreased thickness, abnormal WT + MO2-jmjd6 standard conditions Fig. 3 from Hong et al., 2004
somite development disrupted, abnormal WT + MO2-jmjd6 standard conditions Fig. 5 from Hong et al., 2004
anatomical structure jmjd6 expression spatial pattern, abnormal WT + MO2-jmjd6 standard conditions Fig. 5 from Hong et al., 2004
hindbrain decreased size, abnormal WT + MO2-jmjd6 standard conditions Fig. 6 from Hong et al., 2004
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.