| Morpholino Name: | MO1-tncb | 
    
        
        | Target: | tncb  (1) | 
    
        
    
        
    
    
    | Previous Names: | MO1-tnc, 
            
                tenascin-C morpholino 1 (1) | 
    | 
    
        Attributions for Alias: {{control.newAlias}}
     
    
        Delete Alias: 
        
    
    (Including Attributions)
    
 | 
    
    
    
        | Sequence: | 
                        5' - GAGAGGATCTCACAGGACACTCC - 3'
                        
                     | 
    
    
        |  | (Although ZFIN verifies reagent sequence data, we recommend that you
                    conduct independent sequence analysis before ordering any reagent.) | 
    
    
        | Note: | This morpholino targets the 5' UTR region adjacent to the translational start site of the gene tnc. |