| ZFIN ID: ZDB-SSLP-980528-1406 |
| SSLP: | z10517 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 5 | 39.7 cM | z10517 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 5 | 1986.0 cR | z10517 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 5 | 39.2 cM | z10517 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z6371 | SSLP | 5 | Trede et al., 2007 | Trede et al. (2007, Proc. Natl. Acad. Sci. USA 104(16):6608-6613) mapped sart3cz3 to Chr 5 using positional cloning. | |
| ficd | GENE | 5 | Trede et al., 2007 | Trede et al. (2007, Proc. Natl. Acad. Sci. USA 104(16):6608-6613) mapped sart3cz3 to Chr 5 using positional cloning. | |
| iscua | GENE | 5 | Trede et al., 2007 | Trede et al. (2007, Proc. Natl. Acad. Sci. USA 104(16):6608-6613) mapped sart3cz3 to Chr 5 using positional cloning. | |
| cz3 | Feature | 5 | 0.92 cM | Trede et al., 2007 | Trede et al. (2007, Proc. Natl. Acad. Sci. USA 104(16):6608-6613) mapped sart3cz3 to Chr 5 using positional cloning. |
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 210 | 60.0 | |
| Forward Primer | TGGTGGGTACCTTAATCCCA | ||
| Reverse Primer | GGTTGGCAATCACAAACACA | ||
| IND | 204,184 | 60.0 | |
| Forward Primer | TGGTGGGTACCTTAATCCCA | ||
| Reverse Primer | GGTTGGCAATCACAAACACA | ||
| EKW | 210 | 60.0 | |
| Forward Primer | TGGTGGGTACCTTAATCCCA | ||
| Reverse Primer | GGTTGGCAATCACAAACACA | ||
| TU | 210 | 60.0 | |
| Forward Primer | TGGTGGGTACCTTAATCCCA | ||
| Reverse Primer | GGTTGGCAATCACAAACACA |