Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
7	59.1 cM	z8604	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
7	5045.0 cR	z8604	Goodfellow T51 (T51)	Geisler, Robert	Data
7	123.0 cM	z8604	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z10487	SSLP	7		DeBruyne et al., 2004	DeBruyne et al. (2005, J. Neurogenet. 18(2):403-428) mapped lager and limedg2 to LG7 ussing Bulked Segregant Analysis and Meiotic mapping.
z11085	SSLP	7		DeBruyne et al., 2004	DeBruyne et al. (2005, J. Neurogenet. 18(2):403-428) mapped lager and limedg2 to LG7 ussing Bulked Segregant Analysis and Meiotic mapping.
z20715	SSLP	7		DeBruyne et al., 2004	DeBruyne et al. (2005, J. Neurogenet. 18(2):403-428) mapped lager and limedg2 to LG7 ussing Bulked Segregant Analysis and Meiotic mapping.
dg2	Feature	7	4.1 cM	DeBruyne et al., 2004	DeBruyne et al. (2005, J. Neurogenet. 18(2):403-428) mapped lager and limedg2 to LG7 ussing Bulked Segregant Analysis and Meiotic mapping.
z11625	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1059	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z13880	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1182	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1239	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1713	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1798	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z3008	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z6483	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z6852	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z7958	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8156	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8218	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z14401	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z9869	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z11625	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1059	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z13880	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1182	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z20576	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z20715	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1239	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z3008	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z3445	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z6852	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z7244	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z7958	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8156	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8218	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z26442	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z14401	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fgf3	GENE	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z20576	SSLP	7	1.7 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z9869	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z11122	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
fc89b01	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fb64c10	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8252	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8540	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z5467	SSLP	7	1.6 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z14644	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fi19d09	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
dtv43	Feature	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fb64f09	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fb12g02	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fd21a02	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fa11d03	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8252	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
tg413	Feature	7	0.2 cM	Schonthaler et al., 2010	Schonthaler et al. (2010. Mech. Dev. 127:203-219) report mapping bum to LG7,  ... Schonthaler et al. (2010. Mech. Dev. 127:203-219) report mapping bum to LG7, between SSLP markers z8604 (0.2 cM) and z7958 (3.7 cM).
z7958	SSLP	7		Schonthaler et al., 2010	Schonthaler et al. (2010. Mech. Dev. 127:203-219) report mapping bum to LG7,  ... Schonthaler et al. (2010. Mech. Dev. 127:203-219) report mapping bum to LG7, between SSLP markers z8604 (0.2 cM) and z7958 (3.7 cM).
s510	Feature	7	0.1 cM	Xiao et al., 2007
s530	Feature	7		Xiao et al., 2007
col4a5	GENE	7		Xiao et al., 2007

OTHER MAPPING INFORMATION

Chr 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
AB	0,178,154		60.0
Forward Primer	ACTTGCCCAAACACAAAACC
Reverse Primer	TGAAGCAGGACAAAGAGTGC
IND	188,0,146		60.0
Forward Primer	ACTTGCCCAAACACAAAACC
Reverse Primer	TGAAGCAGGACAAAGAGTGC
TU	170,0,188,124		60.0
Forward Primer	ACTTGCCCAAACACAAAACC
Reverse Primer	TGAAGCAGGACAAAGAGTGC
EKW	0,154		60.0
Forward Primer	ACTTGCCCAAACACAAAACC
Reverse Primer	TGAAGCAGGACAAAGAGTGC