Genomic Feature
ulg081
- ID
- ZDB-ALT-240424-7
- Name
- ulg081
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with multiple variants (1)
- Protocol
- embryos treated with
- Lab of Origin
- Martial Lab
- Current Source
- Other Pages
-
Notes
Comment | Citation |
---|---|
adgrl3.1-8ntdel-cr; ulg081 guide RNA : AGGTGCGATCTCAGGCGGCG target sequence: ... |
Zebrafish Nomenclature Committee |
Variants
- Variant Type
- Variant Location
- Chr: 1 Details
- Nucleotide change
- Variant Notes
- None
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- None
- Transcript Consequence
- None
- Protein Consequence
- None
- Flanking Sequence
- None
- Additional Sequence
- None
Fish
Supplemental Information
- Genotyping protocol
- None