Genomic Feature

ihb193

ID
ZDB-ALT-171002-9
Name
ihb193
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Zhan Yin Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 22: 22716952 - 22716961 (GRCz11) (1) Details
Nucleotide change
TGATATCCGG/CAACCC
Variant Notes
Between 161bp and 170bp of the wild-type nr5a2 coding sequence, 10bp is deleted  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
6 bp inserted / 10 bp deleted in Exon 2 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TTCTACCTTTAAACACACAGTCTTTTCCATAAAATCACATTATACACTAAATACATAACAAAAAAGTCCATAGGAATTTGATTTTAATAAAATAAAAACATTGTAATAATTTGGTAGGAAAAACTGAATTAAAACACATTAGATGAGTCTTTAACTAATTTGGAATCAAGTCCAGATTGTGACCCAAAAAATTTACAATACTAAAAATCATTAAAAGCAAAATTTTCATGAATGTGATGGTGCGGTTGTGCTAAATCTTACTTGGATTTGCTTCAAAATACCATTTGAATGGATGCACAACCTTCAAGGTCAACACAAGGTATTTAAAATAGTTCTCTTCTCTCTTCAAACACCAACAAATATTCTAAAACGTAAGCTTTGTTCTGTCCACAATTGTTTTTCTCCCTATCAGAACAATGCTTTTTTAGGGTGACCAGTTGAGAAGATAAAAACAGCTGATGTTACACACCTTACAGCTCTCACAGGTCAGCAACCCATAG
TGATATCCGG/CAACCC ACACCTTGTCTCCGCACACTGGACACATCTCATCCAAGTCTTCGTCGTAGGAGTAGTCCATCATTTTAAACTGTGGGGCTAAAAACATAAGAGTATGAATACAGTGAGTAACAATTTACATTACAGAACCTATTCAATTAATTAATTTATTTTTTGACAAAAAAAATAAAAAATGGTTTGGCTGTCATGTGTTATGAGGTTCGTTTTGAAAGATTAAGAAGCAGCTAAAAAAACAAGAACTGTTTGAATCTCCACAACGAAAAGACTAAACAAATTCAGAGCTTCAATGATTGAAAAAACATCATTTTAAAGCAAATATTTCAATTGTAACCATCTCTTCGGCTAACGTCTACGTGTAGCCTGCAGTTTTTGCAGAAATAAATAAAATACGAACCACCAGTTGTTCACCAAGTCTAGCCTTAAGAGTGAATTTTCTGTAAGAATATGCAGTTTTGGGTCTCTGGGAACTTGACGAAGCTACGAGTCGGGTGTGGAGGATG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations