Genomic Feature
sa14887
- ID
- ZDB-ALT-130411-3515
- Name
- sa14887
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one point mutation
- Protocol
- adult males treated with ENU
- Lab of Origin
- Stemple Lab
- Current Source
-
European Zebrafish Resource Center (EZRC)
(
order this
)
Zebrafish International Resource Center (ZIRC) ( order this ) - Other Pages
Notes
No data available
Variants
- Variant Type
- Point Mutation
- Variant Location
- Chr 14: 57415661 (GRCz12tu) (1) Details
- Nucleotide change
- A/T
- Variant Notes
- None
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- T>A (1)
- Transcript Consequence
- Premature Stop (1)
- Protein Consequence
- None
- Flanking Sequence
-
AGCGAGCGTCTGCGTACCGGCGGTGGGGTTTTCTGAAGACACTCCAGCAG
A/T TAAACCATCTTGGCCTCTTCTTTCACGTACTCCACTTCCTAAAACACAAA - Additional Sequence
- None
Fish
Supplemental Information
- Genotyping protocol
- None