Genomic Feature

s105

ID
ZDB-ALT-090820-1
Name
s105
Synonyms
  • creature from the black lagoon (cbl) (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Baier Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Notes
Comment Citation
Small retina, mitotic defects caused due to loss of condesin complex. A C-to-T  ... ZFIN Staff
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 1: 23563772 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
Small retina, mitotic defects caused due to loss of condesin complex. A C-to-T  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Gln>Stop at position 493 (1)
Sequences
Flanking Sequence
TTAATTAATTGCATCTAAAGGTAAAATGTTTTAACCTTCTCAACTACTGTTTAGGAAGCGCATGGTAGCAGTGCTGCAGGAGATACTTGTGATGCCCAACACACCTGTTTCTCTGATTGGTCTGCTAGTGGAGAAACTTGTCAACATTTTGCGAGATGATGCCCAGAAAATTCAGATGGTGAGTCCTTGTTGAACAACATATTACTTCTGAAAAATCTTCTGTTTGTGAAAGAATGAGGTTTAATCAGTATATTTCTTTGAGATTGACCATGTAGTTTTTCTTGAATGTGCCGACATATTCAAAATTGACCCTAATTGGGTGCTAAAAAGCTGAATAAATAGTTTTTCATGCTTAAAATAAGTTTAATCATTGGCTGACAAATAAATGTAATTGGTTGACTGTGCTATATTTTCTTCAGGTTGCTGAAATAATCTCTGATGTGAGGGAGCCTATTTTCCCCATCTCTGAGCCAGTGGATGAGAATGAGAAACGCAGAAAA
C/T AAGTCAGAGTGAGTTATATTTATAAATCACTGGTGCCTAATGTCATAAATCGATTGCATTCATCTTGATTTAAAAATGTTTTTTGGTAGCTGGCTGAGGTGCGAGTACAGATAATGGAGGCCAAACAGACTCTAGAAGACTGCATCAGCTGTCAGGACTTTAGCCGTGCAGCTGAGCTAAAAGACTCCATCTCTCAACTGGAGGAGCTCAAGAACCAGCTTACCCTGGAGGTTTCACAGCCAGCTGAAAATGTCAAGGAACAGCGTATAGAGAAGGTACAAAATTTACAAGCACATACGTGCATGTGTGTATATGTAGGTACATTAATTTCATCAACTACATTTTTAATTGAGTAATATTTAAACTAATGGCAACAGTTAATTACATTTCTGAATGGTCATGCAGTGCTGAAGACTAGCTTTTACCTTTGTCACAATGGGAGTAAAGTACATAACAAAAAAAATTGATGTTTTAATAAGTGTTTATAATTTTCATAACTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations