Genomic Feature

jj50

ID
ZDB-ALT-090805-1
Name
jj50
Synonyms
  • ale oko (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Malicki Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
Comment Citation
The mutation results in a cryptic splice site, which leads to a 9-bp insertion  ... ZFIN Staff
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 6: 58859703 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
The mutation results in a cryptic splice site, which leads to a 9-bp insertion  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
Cryptic Splice Site (1)
Protein Consequence
None
Sequences
Flanking Sequence
GTCTCTTATTTAATATATCCACTAAAAGACAAAGAAAATATTACTGTACAAATTGCATTGTGCAGTATATACAGTGATATATACTGTACGTACATACAAACACACATATTTATATTTACGTCTGGGGAAAATGTACGTTTTTAGATTTCATGTATTAGACTTTTAATTTGACTCTTATTTTTCTCTTTGCTTCAGTAAAGTTTTATTTATTTATTTATTTATTTATATTTTAATGAACTGATTGATTTTTCTGACTGTGTGTGTGTGTTTTCAGGGGCCGCTCAGCTCCGGGGTTCAGGGCTCCAGTCTGACGGTAAAGCACTGATCAACATCTCCACTGATGGACACATCTATTATTATTAATGCATGATACTGTAAAAGACTGGCAAATGCACACGAGCTGCTGTGCAACCAACAAAACCTACAACAAAACCCAACACACACATTTGTAAGTGAGGTGACATCTGCTGTGATGGCCGTGATAACATGCGGTGTTGATC
T/A GTGTCCATAGGAGACTTTAGAGCTGCTGCAGGCGCGGGTCAGTGCTCTGGACGCTGCTACACTGGACCAGGTGGAGGCCAGACTACAGGTGAAACACACACACATACGCAGATCACACTGATTAAGCCTTTATTAGGCAGTCTTATAACATTCCAGGGTTCCATCCCAGTAAGTAATTCAAAAGCTGTTTTCCGTCTAAAGTTGTGAAATAGATTTGTGCACAAAAATGGAATATTGCTAAAAAACATAACGAATAAAGCAGCATTTTTATCCAACGAGTCAAAGACAATCAAAAAGTCTATCTAATAAATATAATATTACCTATTGTTGTTGTTATTATCATTTATTTATTTTTGAAATGTGACTCTGGACCGCATAAGCAGTCGTAAATCTTCTGAAGTTGAGATTTCTGGGCTGAATAAATCATCTTTCCATTGACGTTTGGTCTGTTAGGGTGGATAATATTTAGCTGAAATGCAATTATTAGACGATCTGGATTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations