Genomic Feature

fh278

ID
ZDB-ALT-090715-3
Name
fh278
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Moens Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 2: 43488245 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
Mutation T347A gives a coding change of L116*.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A at position 347 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Leu>Stop at position 116 (1)
Sequences
Flanking Sequence
GTTTCTAAATATGTTTGGTGTCTAAAATATTATTTTAATGATTATATCTGCTCAATAAATCTGTTTTGTTTAAATTCACACCAAAATACATTGCCTATATTCACTAAGAAATGGATACAAATATTAATTTTCAAAATAGGGTGTTCTCAATTATACTGAGCACTGTATATATATTTTTAAATATATATTATGCATTAAAATGTGCATTTATATTTTTGTTATTTATAATTTTGCCTAGAGTGTGAGATTTATTTTAAGACTTTTAGAATGTAAAACAATAGGAGTATCCACATGCTGCTTATAATGTTGATCTATATTATGTTTCATATAACTGAACAGCAAATATAATCAGTCATCCCACTAAAGTGTTTGTGTATGTGTGTGTTTGTGTAGGTATGATTTTGTACAGGTGTTTGATGGTGCGGATGAGAACGCTCTCTCTCTTGGGAGGTTCTGCGGCAAAATCGCTCCGTCTCCGATTATCTCTAGTGGAAACTCTT
T/A ACTCATCAAATTCACCTCCGACTACGAAAGCGCAGGAGCCGGATTCAGCATCCGCTATGAGATACACCGTACAGGTATACACAAACACACACACTGTCAAAGATATCATAATGCACACACACACAAAGACAAACATATGGTCTTTAATTAAAATACTCATTCTCTGTTTTAATTCTCTTTTGTACAGTTGAAGTCAGAGTTATTAATCCTCCTGAATTATTAGGCGAGAAGATTAATTTCTAAACATGATAGTTTTAATAACTCATTTCTAATAACTGATTTATTTTATCTTTGTCATGATGACAGTAAATAATATTTGACTAGATATTTTTCAAGACACTTATACAGCTTAAAGTGATATTTTTTTAAGGCTTAACTAGGGTAACTAGGCAAGTTAGAGTAATTCTAACAATCAAAAGACAATCAAATAAACATATTGCTTAAGGGGGCTAATAATTTTGACCTTAAAATGGTTTAAAAAAATTAAGAACTGCTTTTAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations