Genomic Feature

uw1

ID
ZDB-ALT-060117-2
Name
uw1
Synonyms
  • bashful (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Halloran Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 24: 41746380 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
For bal uw1, a splicing mutation was discovered that results in a 100-bp  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Splice Site (1)
Protein Consequence
None
Sequences
Flanking Sequence
TCAAACTAGTGACCTTCTTGCTGTGAGGCGATTGTGCTAACCACTGCGCCACCGTGATGCCTGCATCATCAAAATAGTCAGCATTATCGGTCATCATGGCGTACATGCAGACTCATCACCTGCTCAAACTGCACCTGAGACTGGTGTACATATGAAATATACCCAGCACACACCAGATATCAACATGATGTCAGACTGATGTTGTACTCCGACATTGTGGGATGTTGCATTGTGTTTGCTTTATTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATTATTACACTTATTTATGTGATGTTTTTACCCATCATGCTTTGTGTTGCAGGAGTGTGCTCCAGGATATTACCGGCAGGCTGTATCTGAGCTCAACATGAAGGGCAGAAATCGGCCGCTCATTCAGCCCTGTGTGCCCTGCAGATGCAGCAACCACAGCCAGTCATGTGACCTGCACACCGGCCAATGCCTG
G/A TGAGAACACACACACACAGACACACACACTTTGAAGTGCACCTATTATGCAAAACCCACTTTTATATGTGGTTTAACCCCAGCTGTGTGTCAGCAGTGTGTGAGTATCTCCAGCAGCCTCTGATGCTCAACATGTATTAATTGTGTTTGTTCTAATCAGACTTGATGAGTGAAGCACTTTGATTGACATTCTCCCTTTGTACGTGTCATCAGAGGGGGAAAGCCCCGCCCACTAGTGCCCCTCTCTCCATGTCATTAGCATAAACAGCAGCCCTGAGTGAGAAGCAGCCGTCTGTCCATTAGCCATTAGAGTGTTTGAGCTGCTGAAGATGATGTCAGCATAGACTAAGAGCATTATAGATGTGGAGTTCTAGATGAACAGAGACAGGAGCGACAGAGACTGACAGAAGCATGAAGAACACACTGAAGCACACCTGACCAGCACTCACAACACACACACTGCTGATTTACATGTCACTATGCTTATGCATATGCATCTGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations