Genomic Feature

m93

ID
ZDB-ALT-010411-18
Name
m93
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Stainier Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 3: 54617468 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Arg>His at position 150 (1)
Sequences
Flanking Sequence
TCCTCATGTCCTTACTCCGCAAGGTGTAGATCAACGGGTTCAGTGCCGAATTCAGTGTGGCAAAGCTGAAGAAGATGCCAGCGTTATTGAGGATAGGGCATTGCTTCATCTTGCAGGAAGTGTCCAGGAGGAGGATGGTGAAGGCAGGCAGCCAACAGATGATGAAGACGCCAAGGACAATTGTGACCGTCTTCAGGAGAGCATACGCTGGAGAATTGGTGGCCTCTTGGTGGCTGGTGCGCACAATGAGATAGATGCGAACGTAAAGGATCACGATGGACAGCAAGATGATGCTAAAGATGGTGACAACAAACCGGATGTAGTATCGGGTGTTGAGGGGCAAAACAGCTGAGCAATCATCCAGGTTATTAATACAGTTCCAACCTATAATAGGAAGACCTCCTAGAAGAATGGACATCACCCAGCATGCTCCGATCAGAAGAAACATGCGGCACGTTTTGTTGGATCCGTAAACCTTGACCTTGGTGATGGCGATGTAG
C/T GCTCGATAGCAATAGCCAGCAGGCTGAAAACGGAGGCGGACAAAGCAATGAAAGCAGTCCCCTCTCGTATGAACCACTGGACAGGAGTCAAATGAAATGTCCTAGGGCCAGACAGGAAGATGTTGGCAATGTATGCAGAGCCAGCTAGTAGGTCCGAGAAGGCCAGGTTCCCAATGAAGAAGAACATGGCTGAGTGGAACTTTTTATTCCTAAACACAGCGATGAGCACTAGGAGGTTTTCCAAGATGATGATGCTGCAGATTACGACAAATAAAATGTTCAGGGAGCTCAAGCTTTGTTTGCTCTCGATGCGGTCTCTTAGTTCCTCTGCGGTCATCTCCTTAGCAGTGAGATAGTGGACCTGGATGAGGGTCTTGTTGAAGTACTGGGAGTATTTGCTCATGGTGACAGCTTGGCAAAACCCCGCAAACAGACGGCAAGTAGTCATTCAGAGGGCAGCTTTTTTTTGAGCTTGTCTGGGCCAGGCACAGGAAATGAGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
m93.pdf
Citations