Transcript

pdcd7-201

ID
ZDB-TSCRIPT-160112-938
Name
pdcd7-201
Previous Names
  • pdcd7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000063211 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000063211|OTTDARG00000043574| pcdc7|OTTDARP00000049440 pcdc7-001 LG_1 CABZ01088414.1,CABZ01088415.1 Danio rerio protein_coding KNOWN, 1563 bp
CCGCCCCTTTAAGAAGATTCAGGGGCTTTTACTTTGAAGC
GATGCGGGCTTTATTTTGAAGGCGTCCTTCACAGTTTCCT
GTTTAACGATGTTCTCCGAACGAACTTCACAACAGCGCTC
TTGAGCACAAAATTTATGTTGATTTCGGCTTAAAATAATG
GATAATTCTCATCAGTTCGGTTATATGAGGGCTCCGCCAC
CTACATTCTCTGATGCCGCGGGTTTAGATGGCGCTGTTTA
TCCAGGACCACCGCCTCATCATCCTCCACCGCAAGCGGGA
TACTCGTGGGACACTTATCAACACCCTCCACCGGCAGCAC
AGCACCACTGGCCCCAGTTTCCACAATTCGACCCCAGCAG
ACCACCACCAGGGACGTTTGAACCTCCTCAAAACCATGAA
AACCCACCTTCGTCCTGGACGCAGAACCAATGGAGTAACG
TTAACGTTAATATAGACTCTCCAAATCAACCACAATATCC
AAATTCAACCCCTCCCTCATATCAACCTCACAGCAGACCG
GATAATTCAGCTTATATATACACTCCAAAACAGCAGAATT
ACACATTTACTAACAGATATTCCAACGAGCCCCAAAACAT
CCAGAATAAAAGTCCCTTAATAACCGCGTCAGATGAAGAA
GCAAAGCAGAGACTGCGAGACGAGCAGTGGATTCAACGTT
TCTTGCGGACTAGAATCAATTATAATAAACACAATAAAAC
AAAACAAATTAAATACAAACCGTCCATCTCTGAGTTTAAA
GAGAAGCTGTACGGGACTGTTCAAATGCTGGCGGACTTAA
ATCTGTTCTGTCGGAGGCTGAAGGATAACCTGGAGAATGA
AGATGTTTGGACGGAGACACTTTTAAAAGCGACAGAAATG
AAGAATAACCTACAGAAGAGACTGAAGGATCTGAAGGAGC
CCGACTGTATCAGCAGCGTCCAGAGAAAATTACAACAGGT
CAACAAGAAAAGAGCGCGGATGAGGAGGAGGAAGATGGAG
CAGATGGAGGAGAAGCAGGAGCAAGAGGCCAGACGTGCCG
AACGAGAAGCGGAGATCGATAAATGGCAGATGAAACGCTT
TCAAGAAGTGGAGGAGAAGAACAGAGAGAAAGAGTTGAAA
CTGGCTGCTGATGCAGTTCTCTCTGAGGTCAGAAAAAAGC
AATCTGATGCCAAGAGAATGCTGGACATCCTCAAATCTCT
AGAAAAACTCCGAAAACTCCGGAAAGAGGCTGCGGCAAGA
AAAGGTTTGTTTCCGGGGAAAGAGAGTGACGACAGGTTTG
AGGGCCACCTGGAGCGTTTGAGGAGCCTGATCCGCAAGCG
AACAGCCGTGTACGACACTGAGGAAAAGGCTCTGAGAGTC
ATGCTGGAGGGAGAGCAGGAGGAGGAGCGCAAACGAGACC
AAGACAGACGACTCAAGAGAGAGAGAGACAAACTCCTCCA
GAAGAAGAAAGAGCTCCACGCCATGCTGTTCGGAGCTGAA
CTGCCGACTGATCATCCACTTCAGCCATTTCTGGATTACT
ACACTCAGGCCGAGCGCTCCCTTCCAGCACTTATTGAAAT
CAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations