Transcript

rpl14-201

ID
ZDB-TSCRIPT-141209-416
Name
rpl14-201
Previous Names
  • rpl14-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053919 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053919|OTTDARG00000037685|ZDB-GENE-030131-2085 rpl14|OTTDARP00000042362 rpl14-001 LG_ CU596012.20 Danio rerio protein_coding KNOWN, 1070 bp
AGCGCTGAAACGGAAGGCTCTTCACTCCAGAGCGGAAGTG
CCCTCGTTCTTTTTCTACCCCGGTCTGCCATCATGGTGTT
CAAGCGTTTCGTGGAGATCGGCCGCGTGGCCTTCATCGCT
TTCGGTCCTCATGAGGGGAAACTGGTGGCCATCGTGGACG
TGATCGACCAGAACAGGGCTCTGGTAGACGGACCGTGCAC
TGGAGTGAAGCGTCAGGCGCTGCCCTTCAAGTGTCTGCAG
CTCACAGATTACGTCATTAAAGTCCCTCACAGTGCCCGTC
AGAAGTACGTGCGACGCGCCTGGGAAAAGGCTGAGATCAG
CAAGAAGTGGGAGGAGAGCAGCTGGGCCAAGAAGATCGAG
GCCAGGAAGAAGAGAGCTGCAATGTCTGACTTTGATCGCT
ACAAGGTGTCGAAGGCCAAGAAAATGAGGAATAAGATCAT
CAGACACGAGATGAAGAAGCTCCAGAAAGCTGCGGCTCAG
AAGAAAGCATAAACTCTCAATAAACCAGTTTAACTGTAAA
GCAGACTCTGCTCGTCTCTTAAACTCAGTGTATTTTCAGA
TCATTGCTCTGATCTTTCTTCAGTGTGGAACCTTTACTTT
ATAGATGTTAGTTTATGGTGTGTTTACTGGTTCTGAGCTT
TTACTTTAGGATTATTTCTTCTGAAAAAAGAACAGAAAAG
ACTTGAATTCAAATGATACGTGCACACATTACTATATCAT
CCTTTTATATATTAGACTGATTTACTCTTCCGGTTACAAA
ACATACAAATGTGTAAGAAATCTATATTTTGATGGAAACA
AAACCATTTCACTCTCCAAATCTATAAAACACACAGAAAC
TGGTCTGCATTTTGGTAAAATCTGTTTATTTTGCATGACC
TGTTAACTGTAAAAGGCTGTAACTGTAAAATGTGCGTGCA
AGAAGCAACCTTCATTTAATAATACAGCTTTCTTTAACCA
GTCTTGATCTCAATGTTTTAGCATGTTGAATTGTAGCCAG
ACACACATCTGTTTGTTTTGCAGTCTGCTGTTGGCATGGT
TTATCCAAATATGATCGTCACTTCCTCGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations