Transcript

ncoa3-201

ID
ZDB-TSCRIPT-141209-3315
Name
ncoa3-201
Previous Names
  • ncoa3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061134 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061134|OTTDARG00000042364|ZDB-GENE-051107-8 ncoa3|OTTDARP00000047316 ncoa3-001 LG_none BX296530.7,CU929093.5,CU207354.9 Danio rerio protein_coding NOVEL, 6510 bp
TTAAGCTTTGGGAGTGTTTCCCATTTAAACAAACATAGCT
AATGCTGAAGATGGCGGATGCGTAGAAGTGGCTTAAAGAA
ACTGGAGTGTTTCACTGGATACATTTGCACCGGTGCTGAT
ATGTTTTAAGCATGAGTGGAGTGGGTGAGAACTCACTTGA
GCCGTTGTGCTCGGACAGGAAGCGCAAACTCTCCACATGT
GACACACCAGGACAAGGATGTGATAAGCGCAGGAGGGAAC
AGGAGAGCAAGTATATCGAGGAACTGGCTGAGCTGATTTC
AGCCAACCTTAGTGACATCGACAGCTTCAATGTCAAACCA
GACAAATGTGCCATCCTTAAAGAGACAGTGCGCCAGATAC
GCCAGATCAAAGAGCAAGGTAAAAGCTCATGTGGTGATGA
TGATGTCCAGAAGGCGGATGTGTCCTCCACTGGTCAAGGG
GTCATCGACAAGGACCATCTGGGCCCTCTGTTGCTGCAGG
CGTTGGATGGGTTTTTGTTTGTGGTGAGCCGTGAAGGCAG
CATTGTGTTTGTGTCGGATAATGTGACTCAGTACCTGCAG
TATAAACAGGAGGAGCTGATCAACACCAGCATCTACAACA
TCCTGCATGAAGAAGACCGGGAAGAACTGCATAAAAACCT
GCCCAAAAGCAATGGCCCCAACAGTGTGTCATGGGGAGGT
GATTCGTCCCGTCAGAAGAGCCACACGTTTAACTGCCGTA
TGCTGGTAAAGTTTGGACATGGTGGTCCTGGAGGTGAAGA
AGGGGCTGGTGGGCCACGCTATGAGACCATGCAGTGTTTT
GCTCTCACACAGCCTAAAGCAATGATGGAGGAAGGAGAAG
ACCTGCAGTCATGTATGATTTGTGTAGCACGGAGAGTGAC
CGCAGTGGAGAGGACAGAACGATTCAGCACCAGACATGAA
TTATCAGGTAAACTGATTGAGATCGAGCAGCAGAGTCTTC
TGCATACCACCATGCGTCCTGGCTGGGAGGATTTAGTGCG
CCGCTGTATGCAGATGTTCCTGCATCGCAGTGAGGGTCAG
CCCTGGTCATACAAGAGACATTATCATGAAGCATATGTTC
ATGGTAGAGCAGAAACTCCGCCCTATCGCTTCTCCTTATC
GGATGGCACTCCGGTGACTGCACAAACGCGCAGTGAGCTC
TGTCGAAATCCAGTCACCAGTGACCCACACACCTTCCTCT
CTACTCATCTTCTGCAGAGGGAGCAAAACGGATACAGACC
CAACCAGGGTGGTGTAATGCGATCAGTTATGGGTAATGCC
AATCCGAATGCTCAGATGGGCATGGGCAACACTAGGGGCT
ACGGCATGAATGAGCAAGGCCACATGGGACCCAGAGGCGG
AGCAATGTATGGCCCGGGAAACAGGATGAATCAGATGAAC
CCGATGCACCAGATGAATCAAATGAACCAGATGAATTCGA
TGAATCAAATGAATATGAATCAGATGAATTGCATGAATCA
AATGGGCTCAATGAATCAGATGAATCAAATGAATCAAATG
AACTCTATGAATCAGATGGGCCATCCTGGGATGAATCAGC
ACCAGCAGGGCCAGTTTCATGGTGGTGGCGGCTATGGAAT
GGTAATGACAAGTCCCTCTCAAGGAAGTCCGGGAATGAAT
CCTGGTCAGCAGAATCTCATGGGGTCTCCGCGGATACGAG
GGAGTCCTAAAATGGGAGCAAGTCCATTTTCACCTGGAGG
TATGCACTCTCCCATGGGTCCCGTAGGCATGGGTGGCAGT
AGTGGATCTTCAGGTCCATCGGTTGGGAATACCTTCTCTA
GCAGCTCATTGAATGCCCTCCAGGCCATCAGTGAAGGTGT
GGGTTCTTCTCTACCTTCAGCTCTCAACTCACCTGCCCAC
AAATCCGACAGTTCTCCCAATATCAACTCCACTCAATCCA
GTCAGCAAGGCCCGATCGGCAACAACAAACCCATTACCAG
TGACTCCAAGAGTCCATCAAGTGCTCACAGCACAGGGTTA
GACCAGCAACAGGCCTCTTCTACGGAGAACACAGACAAAC
CAGACAGCCAGTCCAACAAGGATGGATCCGCTGGGGGAGA
AGTCAACCGGAGAGTCCCTGATGGAAAAGGCCACAAGAAG
CTACTTCAGTTGCTCACATCTCCAACTGAAGAGATTGGCA
TCGGGACTGCGACTAGTGGACCTGTTCCAGGTCGTGCGTC
CACTCCGATGGGATCTGACCCGAAGGAGACTGGAAGTGGC
ATGATGAGTCCTTCCTCCACAGGGGTGTCCTCTTCATCCG
GTTCATCATCCGGGAATAACGTTAATCAGCAAAGCTCGGG
TGGAGTGTCGTCCACTGCTTGTCCTAGTGGACATCACAGC
ACTCACACCTTACAGGAGAAACACAAGATACTCCACAAGC
TTCTTCAGAATGGAAACACACCCGATGACGTGGCTCGCAT
TACAGCTGAAGCCACCGGCAAGTCCTCGCTTAGTTCAGAA
CACCCGGGTGCTGAGGGGAGGAATCTGGAGCTCAAACAGG
AGCAGCACAGTCCGAAAGAAGGAAAAAAGCCACAAGCCCT
CCTTCACTACCTCCTCAATAAGGATGACTCCAAAGAGCCC
GGTGCTACAGAGGTCAAGCCAAAGCTGGAGGAGCTTGAAG
CAAGAGGGGCATCTGGAGGGCAGGGGGCAGGGGTCACGAC
CTCCAGTTCTAGTAACCAGGAGAGCAAGGTCAAGCTCGAA
CAACCGGATGAGCTGGAAAGTTTAGAGAGTATCCTCGGTG
GGCTGAGGAATCCCGGTCCTGGAATGTTTGTTGATTCTGG
ATCTGGAGGGTCAGAAGTGGGCAATAAGCAGGGCAATGGA
CCTAACAGCACCGCCCACGACCGAGAGGGTGTTGGTATGG
GTTCTGGTCAACGTGTGCCCTTCCAGAGGGCAGTGTCTGT
CGATGGAAAACCTATGAGTGGGCCAGGCATGACTGGTAGA
AAGAGCGCACCATCCTCTCTTGTCAAACAGGAGCATACTG
ATAGCCAGATTGGCATGGGAGGTCCAAACAGGCTCATGGG
AATGCCCAATCGACCTCCAATGGCAGGTGCAGGAGATTGG
ATGTCCAGTTCTGGCAGTCCTGCTGGTTCCGTCGGACACC
CTGGCATGGGTCGCCCAGGCATGGACCACAATCCCAAGAG
CATGATGGGAGGTCCCATGGTTAGCCGATCTAACAGCGTT
CCTGCAACCAGATCCATGTTACAACAGCAGTTGATGGAAA
TGGGGCCGTATGATGTAGGAATGGGTATGAATTCGTTCAG
AGGGCAGGCTCCTCCACCACAGTCCCCTTCGTGGCCAGAT
AGTGGGATGGGAATGGAGGGACCACCGAGTGCAAACAGGC
TGCCGATAAATAGCCCTCTTGATGAACTTCTGGCTCCTCC
ATCCACCTCTGAGGGTCAGAGTGATGAGCGAGCTCTGCTG
GACCAGCTGGACTCTTTGCTCAACAACACTGACGTCATCG
CTCTGGAGGAGATCGACCGTGCCCTTGGCATACCAGATCT
CATCAACCAGGGTCATAGTTCAGATCAGCCTCCTCCATCG
GACCCTTTCTCTGGTCCTTGTCTGGGTCCAGACTCCTCTA
TGGGTATGGAACCTCCCAAGGCGATGTATGGACAGGGCTA
CCCGGGACCCCCTTCCATGGGGATGCAGGGCGGATATGGT
CCCGGTCCCAACCCTGGTGCTGGTCCTGGACCCGGTCCCA
TGCAAGGGCAGTCAGGACCAGGGTTTAATCCCATGATGAG
CCAGATGAACCAGCAGGGTGGCTTCCCTGGGATGGGTGGT
ATGGGCCCAATGCATCCTCGTGCAAACATGATGAGGAACC
GAGTGCCTCAGGCCAAACCTCTCAGATTGCAGCTCCAGCA
GAGACTGCAGGGACAGCAGTTTTTGAACCAGAGCCGACAG
GCCATGGGCATGAGACCTGATGCCAGCCCTGCAGGAAACC
CTGGCATGAGACCCAGCATGCAGCCAGGCATGGGCGGACA
GCCTGGTTTCCTGAATGCTCAGATGATGGCACAGCGCAGC
AGAGAAATGTTGAATCTTCAGACAGAGATGAGAAGACAGA
GGATGATGATGATGATGCAGCAGCAGCAGCAGCAACAGCA
GCAGGTGGCTGCAGGAGGTTTCAGTCCCCCTCCTAATGTC
ACAGCGCCCACAGGAATGGACAACCCCATGGCAGGACCAC
CAATGAGCCAGCCCGGACAGCAGGCCTTTAACTATGGAGG
CAACTATGGTATTGGCCAGCAGGGGGACCCTTCATTTGTG
GGAACAGGTAGCAGCCCCCCTAACAATATGATGTCTGGGC
GAATGGGTGGCCCTCAGAATCCCATGATGCAACAGCACCC
TCAGAGCAACCCCATGTACCAATCGGCAGAAATGAAGGGC
TGGGGACAGGGGCCCATGCCTATGAATAATTCATACCCCC
AGCAACAGCAATATCCCCAGCAGGGGGCGCCAGGACAGTA
TGGTGGAATGATGATGAACGGCTCCATGCAGGGGGGTGTG
AATGGCAACGGTGCAGGACAGATGCCCCCAATGCAGGGCC
AGATGGGCATGAACACCATGGGCATGGGACGCATGCCAAT
GGGACCTGATCAGAAGTACTGCTGAGGCGATGAGCAATCT
CCGTCGAAAAAAAAAGGCCGAACTCACATCAGTCCAACAA
GAAGCTATAAATTCAGCCTCGCAGAAGAGAACAGTTGACT
GAGAGAGGAAAGAGACATGGAAAGGGAAAGAGAGAGATAC
TCAAGCCTTCCCTGTGGGGTTTTTCTGAATTTGCCCAGTA
GCGAGTGCAGCAGGCTCTCTCCTGTCCCGCGTGGCTGTAC
TGCAGTACACAACATCACCACCAGGGGGAACAGAGTAGGA
ACGCTCGTGGTACAACTTGACAGTGTGAGGGAGCACTTTA
TTTTAAGGCTAGTATGGAAAAGGATAGTTGCAATATGTTT
CTTGCTTCTCTAGCCTTATAGAATGATTCTGTGCATATTG
TCTATTTTGAATTCGTTTTTTTTTCGGACAAGAATGAAAA
CCGAGGGAATTGTAAGCACCAGACCTTCATCACTTAACAC
ATATCAAAGCAATAATCCTCCTCTTAATGCCACCGGAGTG
GTGCGTCCACATAAAAAGCAAATGGTACTGCAGTATTAGA
CAGGATCTTTTTTCTTTTCTGTTTTTTTTTTTTTTTGTGT
GTGTGAATAAGATTGGAATTGTAAATACTGTATGCTACAT
ATGTATCATACATGCTTTTACTACATACTTTTTTTGCACA
GAGTTTTTTGGACCCACTTAGGTCCTTCTTATCTATATTT
TAGGTCAATACTTCTGGGTTTTACATCTATTTTAAAGGGA
GAAAATATTTTATTTTTTATCTTTTTTCTTCTGTTAAGTT
TTCCCAACGATGACCGCCAGTCTGTTTGGATGGCACTTTT
TTCTAAAAGGTTTTGACATCGCAGGAGTGTTATGCAGTGA
CGGTTTCATGATTTAACTTCATTTTCAGACGTGCTTCAGT
CCGAAATTATATAGATGAATATATATAAATATGGTGCAAG
TTTTCAGATGGTAAGCAAAGATTATGTTTGATGTTGCTCT
TTAAGCTAGCTCTTATCATGGACAATAACTCACTTTCTCA
CTGTTGGTTCTTCAGAAATCTACCTTTAAGGAACATGCAC
AATCCAAAGATATTTTTTCAGTCTTTTATTTTTCTGTTTT
CTCAAGTTTGACTACAGAAATGTATCCATTTATTATATAT
GTTTTTGCGCAAATGCGCAGAGTAAAAGGTACATATCATA
TGAACATATTACTACATATTATGATTTTGTACTATATACT
GTGTACATACAAAACCAAGTATACCTGTTTATTTTTGAGG
CCAGTTAATATTTTAGCAGTATTGTCTGTGCTTTTTGGAG
GGTTTCTCTTTATCATGCGGTTTATTCACTCTTCAGTTGA
CGTTTTGTAAGATTTTGATGATTATGAATTCTCTACAGAA
CTGCCAAGATTAATTGTAACTATCCAACTGGTTTTAAAAT
GTTTTTTAAACTACTTTTAAAAGCGGTTCAGAAGCGCTTT
TTAAAAGTACAAGTAATAAAGAGTCCATTCAGACAGAAAC
GCTCATCTCTGTAGTGCAGTGTCCTCGGCCGCTTCATTAG
TCCAGTCTTTTACCATCAGTGACTTCAAATAATGTGGATT
CCCAGATGCAGGAACGAAATGTGGTGGGTAATCTAATAAT
AAGTCAGTCTCTTCAGTCTTTTCAGGAAAGCTACGCTGTC
GTTTATGTTCATTTCGCTAGATTACTGTCGATTGTGACAA
AGTATATTTTGAAAAATGATAATTCCGGGAAAATTGAGGT
TATTCTGGTGTGATTTCAGAGCTGATCGATTGACTAAGGG
GTGTGAATTTGGAAGATAAGCTCACATTTTGCAGGATGTA
AATTACAATACACTTAATTATTTTGCTTGATGTTGATATC
GTTGTAAATAAAAGTTCTATTTAAACGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations