Transcript

npl-201

ID
ZDB-TSCRIPT-141209-224
Name
npl-201
Previous Names
  • npl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046010 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046010|OTTDARG00000032865|ZDB-GENE-030131-926 npl|OTTDARP00000036305 npl-001 LG_ CT573380.7 Danio rerio protein_coding KNOWN, 1752 bp
ACAGTTCAATGTTCAGTGCGCTGAGAGAGACAAGAGAATA
ATACTGACCGTGAAAGGAAGAAATGTCTCAACGCGTCAAA
AAGCTCACAGGGCTCGTGGCAGCTACATTCACTCCACTCA
CTGCAGAAGGGGAGATCAACCTGTCTGTAATTGCAGCGTA
CGTCGATTACCTAATAGAGAAACAGAATGTCAAGAGTGTG
TTTGTTAATGGCACAACAGGTGAAGGCTGTTCTCTGACTG
TGGACGAAAGGAAGCAGCTTGCTGCAGCTTGGTGCCAACA
TGGAAAGGGCAAGCTTGAGCAAGTGATTGTCCATGTTGGC
TGCATGAGTATAAAAGACTCTCAAGAACTGGCTCGGCATG
CAGCCAGTATAGGGGCTGATGGCATATCAGTAATATCTCC
ATCCTATTTTAAACCCATCAATGCAGACGCATTGAGGTTG
TTCATAAAGGAAGTGAGTGCCTCTGCTCCAGATCTTCCTA
TGTATTATTATCATCTTCCAGGCATGACCGGTGTTGCATT
AGAGGCAGCTGATGTGCTGAATGGAATCGAGAGGGAGATT
CCATCATTTCAGGGAGTGAAATACAGCGGGACGGATCTGA
GGGATCTCGGACAGTGTGTTTGTTACAGTCAGTCGCGTGA
CTGGTCTGTCCTGTATGGAGTAGATGAGCAGCTCTTGGGT
GCTTTGGTGCTTGGTGTTCACGGAGCAGTGGGGAGCACAT
ATAACTACCTCGGACACATAGTGAACCAGATGCTTTCTGC
TTTTAATAACGGCAACCACACGCAGACCAGAGCCCTGCAG
TTTGGATTTATGGAAGTCATCACATTTGCCAGGACTCTTG
GTTTTGATGTGTCTGTGAATAAGCAGGTGATGAGTGAAGT
ATCAGGGTTACCAATGGGTCCTCCTCGACTTCCATTACTG
CCATGTCCTGTCTCAAAAGCCCAAGCTATAGCACAGAAAA
TCCACAACTTCACTCAGGGACTTTAAAATGAATGTAGAGA
TTTCAGTAAATCTAACTGAAATTCCAAACAAATAATCTGT
ACTGTTTCTTTACACTACAGGATGTTGATGTACTGTATAT
TTTATGTTTGCATGCTTTTATACTTTATATTTTCCTGTTT
TTTTATTGTTAACCCATTTAGCCTTTCTTAGCATTTTCTA
TCTGTAATTAATAACAATAAATGAAAATAACATTGTCAAT
GAACCTACTTAAATTACCTAGCAGTTACTATTATTCCTCA
CTGTTACTGATATCTTTTCTCTGTTGTCATCATTTTCTAT
AAGTTTATGGGATTTCTGTGTTTTAATTGTTTGTGTCTTA
TTGCACAATGTAGCTTAATGCACACACATACTATATGTCT
TTACAATATACTTTTGGTTTTGTATTGTTCAGTACAGTAT
TGATTACACTTTGGCTGTTGATACAATTGTTATTAATTCA
GGCTGCTGAGAAAATGGTTGCAGGGTCAGCCATGATACCA
TTGTGTTCTTTTGTGACAAGTGGCTTTTTTACACCAATTG
CACTGCATGTAATGTACAACAAAAATCAGTTTTATCAGTG
TTTTATGCTCCATTTCAAAAGCGATATGTGTATCAGGTTC
TTCGTAGTAGACACTGTGGTCTATGCTTAATATTTCTAAA
AAATCTTATGTTTGCAAAGAACCATTTAAAAAGGGACATT
TTTATTAATGCTGTATTCATTGAATAAAACTAAATGCAAG
TCTTTCTTTGAGCTTGTTTTTTAAATGCATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations