Transcript

moto-201

ID
ZDB-TSCRIPT-141209-1615
Name
moto-201
Previous Names
  • moto-001
  • dkey-194j22.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053501 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053501|OTTDARG00000037472|ZDB-GENE-070117-1657 moto|OTTDARP00000042079 DKEY-194J22.5-001 LG_ CU062431.6 Danio rerio protein_coding PUTATIVE, 3868 bp
CACCGCAGACGCTTCGCGGGTATACTGGTGAGGAGACACA
GGCTACGGCGGATGATTTGCTTTATTTTATGTCACTCTGC
CCGTCGAAGAGTCGACGTCTTTAATTTATTCTTTAAAAAA
TCAGCCGATTATTTAGGAAAATCGTGAATATAAATATTTA
TAAATCCTAATTTATATCACAAGTAACTTATCGAGCGAGG
CCCAAAGTTTACAGTCAATGGAGGGTAACGTTAATAATGC
AGGGAAAAGCAAAATCAGTGTGGATGCAAATGGAGCAAGA
ACAATCTTGGATCGATTTCAGAATTCAGGAACAGACTCCT
ATTTTACCACCTACAAGCCTCAGACTAGTTTCAGTGACAG
CAGATTTCTGTCTCAGTCGTCCAACTCATTCTCGAACTGC
CAGATGCAAGACTGTGCTCCACTACCTTACACAGTTTGGT
CAACTCAGGAAGACTGGCCTCAAGCTATAACCAATAGCAG
AAATTCGATAAATGGCAATAATTGTGGCAGTGAGGCTGAT
CTTTATGGATTAGTGTCAGATATCTTGGATGAACCAGATT
CAGTGGACCCCTACCCCTCATATGAGAACAGGCTACCATC
TAGTTTGAAAGGTGTATGGTCTCCAAAGTTAAGAGAAAAC
AACATGCAGTATTTCAACAATGAGATGCAGATGCCACCCA
TTTCTGGATTTCCATCAAACAATATTAATCCTAAACCAGT
CACCAATGTCTGCCCTCAGCCTTTGGGTAGAGAATTTCAA
CAGTGGGCAGAAATTCAGAACTTTAATGGCTTTGATTCTC
CTCGTAATTTCTCTTCCTGTAATGGAGGGGCTGACATATA
TTCTCAAGACCTCCCTTGTCCACCAGGCCTGAACACACCA
CCATACACAACCAGAAAACCTGAGTATATTACACCTGACA
AAGAAGAAGGATACTTTAACCCCACTAACTCCACATCTGA
TTATATAAACACGGCCAACTCCTATTATTCTTCTCAAAAT
TCAGATGACTCCTATTTCAATTCATCTCATGACTTTTCAC
CAATGAATAAAGATAAACTGAGAAACATCCAATCTTTCTC
TGTCCAGGATGTCAGTAAGCTGGCCTTTCTGTTGGCAGAG
CAGGACATGAACTACTGCAAAGAACCAACCCAGAATGGGT
TTTTAACGCAGAGGAACTATGAAGAAATCATGGCAGAGCA
GAAAAGTCATCCTTTTCAAAGGATGTCAGAGCTTATTTCT
CAAAAACCAAATTTTAAGAATGAGGTGACCCGCAACCTTT
TAGAGCAAAGAGGAGGAAAAGCAGAGGATAAAAAGACTCT
TTTACAAAGACATTATAACACAAATGAATTTTCAGGGTTC
AGGTCATCTAAAGCGTTTTCACCTACTGTCATACCACCAG
CCCTGTACCCAAATAAAGAAACCAGCCTAATGGAAAGTGG
CATAACTCAAACCAGTGTTAATCTCTTTCACCCACTCCAG
CCAAACCATTGTCAAATCCAAGCAAATATTCCAGCAAAAA
CCAGCAGCAGAAATGAATCACAGGGCTTTGCGAATCTCAC
CACAGCTGGGTCAGCTCAATTACTTCCTTCTCAGCAGTTG
TTCCGACCTGCAGGGAGAGTCCCGACTGATCTGAGTCAAG
GGAACGCAGTAAATCTACATGGTGCAATAGGCCAGGTCAG
TCTTGAGGCTTTAGGGAAGGGAACAGGAAAAGTGGACATT
TCAGATTTTGATCTCAAGCTAGAGAACAACAGGTTTACTG
CAGGCCTTATGTTAGATGGTCGCTTTAATCCGCGATCTAG
CATGAAACCCAAACTTCCGGAGGCAGAGAATAAAGCTGGA
CTGCTGCAGAATCCATACCATGGGCTGGCCAGTTTGTATG
AAAGACAAGTAAGACACAACGAAGCTAGTTCGAGTTCAAC
CACACCATCACACCCTTTCCCATTCCTATATCAAATGGGT
GATCCCAGAAAAAGTCAGTACCATTCACAGCCTTCACTGC
CCTTCTGCTCTGTGCCTATTATCAATGTGAGTGAACGTCT
ACCAGATGCAGATATTTCACCCTTCAGCCCCTATCTACAA
GAATGTGCCGGGCTAAGCCAAGCATCAGGAGATGGGTTGT
TCTCAGGGTTTCTCTCTGCTATGGCTTTGCCTAAGCTTGG
CAAAGCACTTGGAAGTCCCAACAGTCAGCTACACTTTTAC
CTGGAGGAATGTTACGAGCAGTGGAGGATGCTGGAAAAAG
AGAGAAAGAGAGCGGAAGCTATTCTTACAAAGGCTTACCT
GGGTAAACTTGTGTCTATGGTGGTGACCAGTAGCAGCTTA
CCCAAAATGCCTCCAAACCCCTCCAGAGTGGACCGGCTCA
TTGTGGATCAGTTGCGTGAACAGGCAAGAGTGACAGGTTT
GCTGGGGAAGATGGAACAGTTGCGGAGTTTTCCACTTCAT
GCTAATATCAGCTCAACATTGGACAGGCATCTTGAGGTCA
TCTACATCACTCAGGCACGCCGCAAGGAGGAATTCATCAA
TGCTAGCAACAGACAGAGGCAGCCGGCGGCCTTCTTTAGA
GAGGACAGGGAGATTCTTATGTTGGCATCTGCAGTGAAAG
ACCTGTGCATCAGCACCAGAAAGGCCAGAACTGCTCTTTG
GTGTGCATTACAAATGACTTTGCCCAAAACAAGCAGTTAC
CAAGAGGAGGAACTTGACAAAGGTACTTGCTCCCCTTTAG
GCCCAGACAGTCCTGAGCAGTGCAGGTTGGAGAGATCACA
GACTACCCTGTGATGCCTTTCTGACAGGTATATGGTGTTT
GTACGTTTTTTTTCCAAAAAAGTACATTCATCTAAAAGGT
GATGAGGTTGCATTTTAAGAGGAATGAATAAGTTATTTAA
GTTATTCCACTATAGTGACACATTAGGCTCAGTTGTGGGC
AGCAGATGGAATTCTTAGTTCATTAATATTTATCAGTCTA
CTGTGGAAAGGACCAATCAGATTCTCCAAAAACATGGAAT
TATGGCAGTAAGATCAGTATTGAGGTATTTGTCCAAGGAT
CCCAGAAAAAAACTGCCAGTTAGAACAAAATGATTTGAGA
GAGATAGCATAAGATTGATTTAAGAAGAAAGAGTAAGAGA
GATGAATTCACAAGAGGGAACTTTTAACTGTTGATAATGA
AACCAAATGTGTGGCAAGAGTAAAATCTGTGGCTTTGGAA
GATAATATTTTTGCCTCAGAAATGTCAATTGAGAAATATA
TAAATAGTTACATAGGAAACAATTATTTGCGTTAAAGGTC
TTTTGACAGTTTAATTAGTGTCTCCTACAATCTACGATCC
TCAGCACATTTTAGGCATTCACAAAAACAGTATTTATGAC
CAGTAGGACATGTTCGCGTTGTCCTGGCCTTATTTATTTG
AGCAAGATTTTCTTGGCGTCAGCACTTGTTTTTAGTGATC
TTACTGGATAAGCAATAACAACCCCAAATCATTACATAAA
TCTGTCGTTTGTTTTAGGGAAAAACTGAATGTGAGTTTAT
TTATTCACCGTTTGTTTATCTAAATTCTGAATTTAGCTCA
AGTTTCCAGTCGCCATTTTTCAGTGTATGTATGTGGTCAA
TCTGTCTGTGGTGTAACTCTTTTGAGGATCTGCGGAGTAG
CTGAGAGTACCATCATTCATGGACTGACATAAATGATGTA
AATGACATGTTTAAAGGCTAACATTGTTCATATGATGTGT
ACTCATACTGTATCGTTTCATTGCTTTTGTTCAAGTTTTC
CAATTAAACTAACAGCAGTAAATCCCTTAACTCAAAGACT
GGTGCTTAACATACAGTGTTAATCAATGCTAAATCAGCAT
TTCTGCAGTATATTTTACTCATTATTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations