Transcript

cdk1-201

ID
ZDB-TSCRIPT-131113-713
Name
cdk1-201
Previous Names
  • cdk1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055412 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055412|OTTDARG00000038653|ZDB-GENE-010320-1 cdk1|OTTDARP00000043460 cdk1-001 LG_ CU861473.6 Danio rerio protein_coding KNOWN, 1367 bp
CACACACACACAACATCCGCAAGCTTTTTCATTCCTCTAA
AATTTCGAGAACTCTGTTGGACGTAGGACAGTTTGATATT
CATCCATATTAGATATAGTTACAGAAAAGAGTGTTTGGGG
AAAATGGATGACTATCTGAAGATAGAGAAAATTGGTGAAG
GTACGTATGGTGTAGTATATAAGGGCAGGAATAAAACCAC
AGGACAGGTGGTGGCGATGAAGAAGATCCGTCTGGAGAGT
GAGGAGGAAGGCGTTCCCAGCACTGCTGTCAGAGAAATCT
CCCTCCTCAAGGAGCTCCAGCACCCAAACGTTGTACGCCT
GCTAGATGTGCTGATGCAGGAATCCAAATTATATCTAGTT
TTTGAGTTTCTGTCCATGGATCTGAAGAAATATTTGGACT
CCATCCCATCAGGCGAATTCATGGATCCTATGTTGGTCAA
GAGTTACCTTTATCAGATCCTGGAGGGGATTCTGTTCTGC
CACTGTCGCAGGGTTCTGCATCGAGACCTGAAGCCCCAGA
ACCTGCTTATCGACAATAAAGGTGTAATTAAACTGGCAGA
TTTCGGCTTAGCCCGTGCCTTTGGGGTCCCAGTAAGAGTC
TATACTCATGAGGTGGTCACTCTGTGGTACAGAGCTCCAG
AAGTGCTGCTGGGGGCTTCACGCTATTCCACACCTGTAGA
TCTCTGGAGTATTGGCACCATCTTTGCTGAACTCGCCACC
AAGAAACCTCTCTTCCATGGAGACTCCGAAATAGACCAAC
TCTTTAGGATCTTCAGGACTCTGGGGACCCCTAACAATGA
GGTCTGGCCAGATGTTGAGTCTCTGCCAGACTATAAGAAT
ACCTTCCCAAAGTGGAAATCTGGGAATCTGGCCAACACTG
TGAAAAACCTGGACAAGAACGGCATCGACCTTCTCATGAA
AATGCTGATTTATGACCCCCCTAAGAGGATTTCGGCACGA
CAAGCAATGACACATCCGTATTTTGACGATTTGGATAAGA
GCAGTCTTCCAGCCAGCAACCTCAAGATATAAACACATAC
ACATGCATACTAAAGCAAGCAATGTGAGCGTAGGGCTCAC
GGTGAATTCTGGGAGTTCAGAGAGCCCGGAGATGTAGATT
TACTCCTCCAACCTGCAGTAATGCAATCCGAGTCTTTTGA
CACGCAATAATCAACCTTCAGTTTGTTTGTTTGTCAACTG
GGTGGTTTTTCCTAATTTTGTTTGTTTTTTTGTATGTCTT
TTTCTATCCTGTTATATGTTACATAATACCCCTTGTAAAT
AAAACGTGTATTTTTTGTCGACCTGAAGTGGTATATAAAA
AGAATAAATTAAGGTGTTCCCAATTAAGAGCACTTTGTAG
GATCCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations