Transcript

ep300b-202

ID
ZDB-TSCRIPT-131113-3372
Name
ep300b-202
Previous Names
  • ep300b-001
  • dkey-271f3.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049719 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049719|OTTDARG00000034994|ZDB-GENE-080403-15 ep300b|OTTDARP00000039002 DKEY-271F3.1-001 LG_none CU463950.5,CR936416.6 Danio rerio protein_coding NOVEL, 10791 bp
AGTGAAGGAGGCAGGAGCGACCGAAAAAAAGCCACTCGAG
CGCCGACCACTGCGACTCTGAGCGCCGCCGGCTCCGTCCT
CGCGGATCCAGACCGGAGAAAACACAAGCCGGGCGGTTAG
CGGAGGACACGGAGGGCAGATTACAGATTCTCCCGTGTGG
AAATCAAAGAGCAGACTGGTTTTGCCTTTCTTTTTCTGTT
CTTTTTTTGAAACGGAGCGGAGAGGCGGAAGAGGGCAATA
CATTTAAACGAAGGGAAGCTCGTCAGGGGAAAAGGAAAAT
AACAGCGTCACGAAGTGGGAATATCTGTGAAATTACATCG
CCGGTTGCTGGCGGACGACAGCGAAAGTGGGGAAAATCGC
AGGAACTGTGCAGGAGAAGGGAGAAATTTAAAAGGGATGA
ACGCGCAGGGGGGTTCACAGCATCACAAAGCCTATGAAAG
GGGTTTGAGGACCCCCAGATTTTGGGGGGTGCAGCTGGCA
ATATCACCCGGATCGGCAGATGCTTCAGACCCCAAATATT
AGTGAAGCCAGCCTCGTTTCGGTCCATTTCTATTTTCGAC
CCACCGCTGTTCCTCTCGCTCTTTCTTATTGCTCCGCGAA
GAAGCTCTCGGGCTGTGCAGTGACAAATTATTCTTATTTG
CTCGATGTGTCAGTGCGCTGAAATACAGGCAAATGCATTG
AACAACTTCACTCGATTCCCATTCTTTGGCTCGCGACTTC
ATCTTCTCGCACTTCGACCAATTGCATACATGTTCTGTCC
GCTAGACAGCCACTTTTAAAAGCATTTCTTTGCATTTTGC
ATGCACGAGCTGTGCGCAGTGCAGGGTGGTCTCCTGAAGC
AATGGTCAGAGATTTTCTGCAAACACTTTTAACTCGTGCA
GTGGACACATTCACACAGAGGGCGCACGAGCCATATTCAG
ATACGAACGCACAATAAACCATTGAACTTGTCACTTTGAA
GTGTTGTTGCAAAATACCACGACATGGACACTGAAATATG
CAAGTTGTTTGGAATCGTTTAACGCGGTAGTCCGTGCATG
CAAACTGAAGTCGCCTCAGTCCTCGAGTGCACATTTCTCA
TGTTATTTATTCTGCAAAGAGTATTATGTAAGGACGAAAG
GACACCTTTACATTGTTTAATTGTATTCCGAGTATTTATT
CGTTTTCTCCATCCGTCTTACTTTCTTGGAAGGACATAAA
GGCATTGATGAAGAAGATTCACACATCTGTGCTAGTTTTG
AGGTGCATGGTGGACTTTTAATCTTCGAAGTACAGTGATG
CTGGCCGAGAATTGCACATGCTACAATGTAAAGAAGAAAG
ACACACAATTCTGAATCCGAGTGTTTGATCGGGAGCATTG
CACGAAGCGGAGTGAGTTCGCTTTCTCGTACACAACGCCT
TTAAAAAAAAAGCAACACTTCAGTTCGCCGCCGACAATGG
CGGAAAAGACGGATGCAAGCAGCGAGGATAAATCTCGGGA
AAATTGCTCGGTCGCCGAGGAGGCTACGTGAGTTTGCGGC
GAGCTTGCATGACCGTCTGTTCCTCCCTTCACCTCCTCCT
TTCGGAAATATACTTTGAGGAGCTAAAGACTACAAATTCT
TAAAAGGGAGCATTAAAGGTGGACTGAACACTCAAGCATT
GCATTGCATGCATGTATCGTCCCATGAAAGGGAAACGGGA
ATCCGTCCGGTGTTCGTGAACGGGGAGATTTCATTCGCTC
ATCGGCTAGCGACTGCACAGGAAGGGCTATCCTACGCGGG
ATATATGCTTTAACACTAAACCGGAGGAAAACTATGGCCG
ATAATGTGCTGGACTCCGGTCCGCCTACAGCTAAGAGGCC
TAAATTGTCTTCCCCGGCTCTGTCGGTCTCCGCAAGCGAT
GGAAACGATTTTGGCTCTCTGTTTGACCTGGAGCATGACC
TCCCAGATGAGCTCATTAACTCCTCCGACCTGGGCCTTCC
AAACGGGATGGACCCCAGCCAGTTGCACACCAGTCTGGGT
GGAGGAGGGATGTCAGGCCCTTTGGGCGTCTCGGGCCAAG
ACACTGCGGCCAAACACAAGCACCTGTCTGAGCTCCTCCG
CCCTGGTGCTCCTCCATCCGCCTCCACGGCCACCGGCAGC
CCCGGTAACGCTGCCTCCTTAGGAATGATGGGAGGTCTGA
GCGGTGGCCCTGTTACTCAGGGAATGGGTGGCCCTCAGCA
GCAGCCTAGCATGATGCCGCAGCCTGGCATGGTGGGGGGA
CTGAACCGAGCCATGATGGGCACCCAGAAAGGGAATGGAC
AGCCGCAGAGTATGATGGGTGGGCAGATGATGAATGGTGC
ACCTAGAATGGGCTACGCCAATGTGAACATGAATGCAGGC
ATGGCTGGCAACGGGAATATGCTGCCCGATTCTCTGCAGC
AGCCAAATGCAGGGCAGCAGATGGCACAGGCAGCAATGAG
ACCGCAGCAACCAGGAGCAGTGAACAAGATGGGGATGATG
GGTGCTCCAGGCCCGTATGGCGGTTCATATGGTCAGTGCG
GAGGACAGTCTCAACTTGGGCCTCAACTCCAAAACAAAGC
GGGTCAACCAAACAGCATTAACCAGTTTAATATGGACAAG
AAACCTCAGCTTGGGCAGAACATGGGTGGCATGCAGGGCC
CAGGTGTGGTGGGTGGTGTATCGGGGCCAGGTGGGACGGC
AGCGCCCCCTGCCGCGGACCCAGAGAAGCGTAAACTGATT
CAGCAGCAGCTGGTGCTGTTACTGCACGCTCACAAGTGCC
ATCGCAGAGAGCAGGCCAACGGAGAGGTCCGCCAGTGCAA
CCTGCCTCACTGCAGAACCATGAAGAACGTCCTCAATCAC
ATGACGCACTGTCAGGCCGGCAAATCCTGCCAGGTGGCTC
ACTGCGCGTCCTCCAGACAGATCATCTCTCATTGGAAGAA
CTGCACACGGCATGACTGTCCTGTCTGCCTGCCGCTAAAG
AGCGCCGGAGACAAAAGAAACCAGCAATCTCTATTGGGAG
GTGCTGGGATGGCCATGGGTGGTCCTTTAGGTGGGTCATT
ACCTGGTGGCCAACCTTCAGCTCCAAACATTAACCCACCC
AGTCAGATTGACCCAAGCTCCATCGAGAGGGCGTATGCTG
CTCTTGGACTCACTTACCAAGGGAACCAAGCATCCAATCA
AAATCAGCAGACCTCTGTACCCGGTCAACCTGGCATGAGG
TCGCTCAACAACATGGGTGGGAACTCAATGGGAGTGAATG
GAGGAGTCGGTGCGCCGATGTCAAACCAGCATCCAGGAAT
GCTGCCCGATGGCATGCTGCACAGGAACATGACCGCTCAG
AGCTTGATGAATGACAGCTCTGGTGTTGGTAACATGGGCT
CTGCTGCGACCGCTACACCGCCCTCTGCTGGAATGAGGAA
GAGCTGGCATGAAGACATCACACAGGACCTCCGCAATCAC
CTTGTACACAAACTTGTACAGGCCATCTTCCCGACTCCAG
ACCCTGCAGCGCTGAAGGACAGGCGGATGGAAAACCTTGT
AGCTTATGCACGGAAAGTGGAGGGCGACATGTACGAATCT
GCAAATAGCAGGGCGGAGTATTACCACTTGTTGGCGGAGA
AGATATATAAGATTCAGAAGGAGCTGGAGGAGAAGAGGAG
AACCAGACTCCAAAAGCAGGATGGTCCTCATTCAGATCCG
TCTTTAGTTCAAGCCACTGGTCCCAGTCAGATGGTCAATC
GCATGCAGAATCCTGCTGGTATGAATCAATTTGGCCAGGT
GGGGATGCAGCAACCAATGGGACAGAGGGCCACGCCTCCC
CTGCCAATGGGTGCAAACCTCAATCAGATGAGCATGCAGG
GAACACCTCGAATGGCTCAGCCCAATGTACCCCAGTTACA
AAACCAGTACATGCAGAACCAGTTTACAGGAACGGGTGCT
GGATTGGGACAGGGTGCGGTTGGCCTGAATCAACCTGCAG
GGCAGGGAGCCATGCCGCAGAATCAGATGCCCACTCCACC
ATCACTATCAGTCCATAGTCCTGTAGCTCAGTCCCAGTCG
TCAGTCCCAGTCTCTGGAGCCGCTGCTGGCCCTCAGGGGC
CTCCGTCCAACCACCCTCCACCTGCTCCTCAGCCCGGTCT
GCACACGCACTGTCCTCCCTTACGCCAAAACTCCCCTTCT
CCCGCACGTAGCCTCACCCCTACCCCTGCCCCGCACCAAA
CACCCCCGCAGTTGCCTGGTAACCAGACCCCTCAGCCCCA
CACCCCTAATTCATCCACCACTATGGCTCCACCTGCATCA
CAGCTGCCCCCTATGGCACAGGGGGTGGCCTCCGAAAAAT
CCAGTCAGTTACAACAGCAGTCGCATGGAGGTGGAGCTAC
TGGAGGCCCCCAAACAGGGCTGGCGTCATCTGTGCCTTCC
CAGAACGCCCACGGGCTTTGTACACACCCACATAGTCCTC
TCTCTCAGAAATCATCTGCGACTGTGGACGGTCAGGCCTC
GACTCCTGCCTCAGTCAGCAGTGCTGACCCTAGTTCACAA
CTGACATCATCCGAACCCACAGCCCCTCTTGACTCCAAAA
CTGAGGTCAAACAGCAGGATGAAGAGGAAGAGAATGAGAA
TGAGACTGAGGACAAGGCCTCAGGGAAAATGGCCGCCATG
CAGACCGAGATCAAGTCTGAGGAGAAACCAGAGAAGGAGG
AGCCTGCAGGTGATGAATGTAAGACGGAGCCAATGGAGAC
ATCCACAGCCGAGGACAAGAAGCCGGAGGTCAAAACTGAA
CCCAAAGAGGAGGAGGTTGCAGGAGCCAACAGCACTCCCG
CAAACACACAAAGCAAGAAGAAAGAATTTAAACCAGATGA
GCTCCGCCAGGCTTTAATGCCCACTCTGGAAGCTCTGTAC
AGACAGGACCCAGAGTCGCTGCCCTTCCGGCAGCCGGTGG
ACCCCCAGTTACTGGGAATACCCGACTACTTTGACATTGT
GAAAAACCCCATAGACTTGTCCACTATCAAGCGTAAGCTG
GACACGGGGCAGTACCAGGAGCCCTGGCAGTATGTGGATG
ACGTGTGGCTGATGTTCAATAACGCCTGGCTGTATAACAG
AAAGACGTCACGGGTTTATAAATACTGCTCCAAACTGGCC
GAGGTCTTCGAACAGGAAATAGACCCTGTTATGCAGGAGT
TGGGCTACTGCTGTGGAAGGAAGTTGGAGTTTTCTCCTCA
AACTCTGTGCTGCTATGGCAAACAGCTGTGTACCATCCCC
CGAGATGCTGCGTACTTCAGTTACCAGAACAGGTACCACT
TCTGTGAGAAGTGTTTCAACGAAATCCAGGGGGAGAATGT
GTCCCTGGGGGACGACCCAACCCAGCCACAAACGTCCATC
AATAAAGACCAGTTTCAACGTAAGAAGAACGACACCCTCG
ACCCTGAGCTACTGCTGGAATGTGGCGACTGTGGTCGAAA
AATGCATCAGATTTGCGTTCTGCACAATGAGACAATATGG
CCGTCAGGGTTTATCTGTGACGGCTGTCTGAAAAAATCCA
ATTCCACAAGGAAGGAAAATAAATATGCAGCAAAGAGGCT
TCCTCAGACAAAGCTTGGCAACTTTCTGGAGACACGAGTG
AACGATTACCTGAAGCGCCAGAATCATCCAGAATCTGGTG
AAGTCACCATCCGGGTGGTGCACATCTCTGATAAAGTGGT
GGAGGTCAAGCCTGGCATGAAGTCCAGATTTGTTGATAGC
GGCGAGATGTCAGAATCATTCCCATATAGGACAAAAGCTC
TGTTTGCATTTGAGGAGATTGACGGAACAGATGTCTGCTT
CTTTGGAATGCATGTTCAAGAATACGGCTCTGATTGCCCT
CCACCTAATCAAAGACGTGTGTATATATCCTATCTAGACA
GTGTGCACTTTTTCCAACCCCGTCATTTGAGAACAGGAGT
CTACCATGAAATTCTCATAGGATACTTAGAGTACGTTAAG
AAAATGGGGTTTGTCATGGGCCACATCTGGGCTTGTCCAC
CGAGTGAAGGTGATGACTACATCTTTCACTGCCATCCATC
TGATCAGAAGATTCCCAAACCAAAACGCTTACAAGAGTGG
TACAAGAAGATGCTTGACAAAGCAGTAACTGAGAGAATTG
TACATGACTACAAGGACATTTTTAAGCAGGCAACTGAGGA
TCGTCTGACCAGTGCGAAGGAGCTCCCTTATTTTGAGGGT
GACTTTTGGCCTAACGTATTGGAGGAGAGCATCAAAGAGC
TGGAACAGGAGGAGGAAGAACGGAAGAGAGAGGAAAATAA
CACCTCTAGTGAAAGTATTGATGCGACCAATGGTGACAGC
AAAAATGCCAAAAAGAAGAACAATAAAAAGACTAGCAAGA
ACAAGAGCAGCTTGAGTCGAGCCAATAAAAAGAAACCAGG
CATGCCAAATGTCTCCAATGATCTATCCCAGAAACTTTAT
GCTACAATGGAGAAACACAAAGAGGTTTTCTTTGTTATCC
GTTTCATCGCTGGCCCTGCTGCCAATTCTCTTCCACCCAT
TTCGGACCCTGACACGCTAATGGCCTGTGATCTGATGGAC
GGCCGAGATGCTTTCTTAACGCTAGCACGAGACAAGCACC
TTGAATTCAGCTCATTGAGGAGGGCCAAATGGAGCTCCAT
GTGTATGTTAGTAGAATTGCACAATCAGACTCAGGACCGC
TTCGTCTACACATGCAATGAATGCAAACACCATGTTGAGA
CGCGCTTCCATTGCACTGTTTGTGAGGATTATGATCTTTG
CATCACTTGCTACAACGTTAAGGGCCACGAGCACAAGATG
GAGAAACTTGGACTGGGTCTTGATGATGAGAGCAACAACC
AAGCTGCTGCCTCCACCCAGAACCCTGGTGACTCGCGTCG
TCTCAGCATCCAGCGCTGCATCCAGTCTCTGGTGCATGCT
TGCCAGTGCCGCAATGCTAATTGCTCGCTGCCATCTTGCC
AGAAGATGAAGAGAGTAGTGCAACATACAAAAGGCTGCAA
GCGCAAGACCAATGGTGGCTGTCCAATCTGCAAGCAGCTC
ATTGCACTATGCTGCTATCATGCTAAGCACTGCCAGGAAA
CTAAGTGTCCTGTGCCCTTCTGTCTCAACATCAAGCACAA
GCTTCGTCAGCAGCAGTTGCAACATAGGCTTCAGCAAGCG
CAAATGCTGCGTAGACGTATGGCCACTATGCAGCGAGTAG
GGCAGCCACCACCATGTGGAGGTGGGCCTCCAGGAGGTCT
TCCATCACCTGGCAACAATGGAGCAACAGGTCCTAGCACA
CCTACGTCAGTTGGTACGCAGCCGGCAACACCCCAGACGC
CCACACAGCTGACACCCAATCTTATATCTTTGCCCCAGCC
TGGTGCAGGAGGAGTCCCAGCTGGAGCTCCCCAGCAGTCT
CCTCAGCATCCTGTCCACCACCAGTTTCAGCAGATGCCTG
GAGCAGGAGGCATGATGAATTCACAGCAACAACAAATGGT
TCCTCAGCAATCATTGGGACAAGTGCCACATCCACACAAT
CAATATGGCCCCCACCCCACAGGTCCCTCCCCAAATACCC
AGTCCCAGGGTAAACCAGGCCTTGGTCCTGCAACTCCTCC
GCAACTCCCCAGCAACCCAGGCACTGTACCTATGGCCCAG
CAACAACAACCTACAGGTCCTCCGGCAGCCGCTGTGGAGA
TTGCCATGAAGATTCAGCAAGTGGCAGATGCACAGCGGAA
AATGGCACAGGTTCAGTTGCTACAAAGACAAGCTGCCCAA
GCAGGAATGATGCCACAGCACCATCAGCAGCCACAGGGAC
AGATTGGAGTGGCCCATCCTGGAATTGGTATGGTAGGGCC
ACAAGGCTTAGCCTCGCAGGCACAAACATCAGCGAACAGG
GTGCAGATGGAGCAGCAACAAGGACCTCAGGGAATGATGG
GAGCCGGGCCCATGCAGCAACAGCAGCCTCAACAGGTCGC
TGTGCAAGGTCAGATGCCCCCACAAATGCATCCACAGCAG
CCGAGAATGAATCCACCACTTCAGCCTCAACAGCAACAGT
GGCCAGGGCAGGGCATGCCTACCCAGCAGAGACCTGCTAT
GATGTCTCAGCAGGGAATGGTTTCAATGCAGCCCCAACCG
CAGCCGCAACAACCATCACAACAAACGCAACAGCAGCAAG
CACCCCAAATGCCAAATCGAAATGCCTTGATGAGTATGGT
ACAGGCTGGTCTACAGAGTGGCGTAGCAAGTGGGGCTGCA
GCTAGCAATTTGCCCCAGGGAGCCTTGCAGCAGCTTTTGC
GGACTCTGCGATCTCCAAGCTCTCCTCAACAGCAACAGCA
AGTTCTCAACATTCTCCGGTCTAGCCCACTTCTAATGGCA
GCATTTATCAAGCAACGGGTTCACAAGTATAAAGGAGGTA
CAGGTGGCCCCTCTGGACCGCAGGGAGGGCCAGGACCTAT
GGGAGGCCAACCTGTGGGTGTCAATACTGGGGTTCCCCAA
CCTGGTATGCATCTTGGACAAGGTGTTAACATGCAGAGTC
AACTTCTGAGTCAACAACAGAGCCAACAGCAGCAGCAAAT
GCAACAACGACCGCTCCTGCAACAACAGCAAGTTGCTGCC
TTGCAGCAGCAGCAACAACAACAACAACAGCAGCAGCAAC
AACAACAGCAGCAGCAGCACCAACAACAACAACAGCAGCA
GCAGCACCAACAACAACAGCAGCAGCAGCAAGGGATTCAA
GGACAGGGGACCCCAAACATGGCCAATCCACACTTCCGAG
AACTAGTCATGAGAAGGCAACAGCAATTACAGTTTCAGCA
GCAACAGCAGCAACAACAGCAACAACAACAACAACAAATG
AGCAATCATGCGGCATTCCAGCAGCAGCAAGGTTACATGA
GTCAGCAGGGTAACATGCAAGTCCCGCCAGGAGGTCAGCC
ACTGCAAGGAGTACAACCTGGCCAACAGCAGAATTTTCCT
GGAAATCCTGCACAGCAACAAGCTGCAGCTGCTTTGCAAC
AGAGGCTTGCGCAGCAGCAACATCAGCTACAGATGCAACA
GCAGCAGAATGCTGCAACACAAGGTCCTGACATGGGACCT
GGAGGAGGTCCACAGCCCACACAACTAGGTCCAGGTCTTC
AGTCACCACAGGCATTATTGCAACAGGCTTTGCATCAGCG
TCTATTTCCGCAGCAGCAGCATCTTAGTGGCACCTCTCCG
GCACAGCAAAACAACCCAATGAGTCCACAGCAGCAACAGA
TATCTCAGTCGCCCCACTTGCAGGGCCAGCAGCTCCCATC
CTCCCTCAGCAACCAGGTCTGTTCACCACAGCCATCTCCA
CGACCCCAGTCCCAGCCACCTCACTCAAGTCCGTCCCCAC
GCCTGCAACCTCAGCCCTCACCTCACCACATCTCGCCTCA
AACCCAAACAGGTTCTCCGCATCCCAGCCATCTTCAGCAG
CATCACTCAGGCATGGCTCCACCTCCTCCACCCCACCAAC
AGCCACAGCACAACTCTAAGGACCCAAGCGGATTTGGCGC
AGATCAGAATGCCATGCTTTCTCAACTCAGTGGCATGGCG
GGACTCCACGGACCAGGAGCGAATGATATGCTGCCTCCTA
GTGGCCAGGACCTTGGCATTAACATGAATCTAACCCTTTA
GATCATATAGTTATTAGGAAATTTACAAAACCTCGCCAGA
GAGTGTTAGCATTTTTTACAAGGGTGAATTTAGTGTTTTT
CAACATTAATGCTTTGAGAACGGGCCCTTCTATGAGAGAG
ATCTCTTATATTCAACACAAATAAGTATATGGGGGTGTTT
TTTTTTTCCTTTTGCCAGATATGTACAAAGAGAGGATTGT
TTCTCAGCCTCAGAGAACAAACCACAAGTAATATTTTCAA
TGTCAGGTCCAGGGGAGTACTTTTCCTTTTTCAAGAGATA
TTTTTTAAGATTTTAAAAGTGGTATAAAAATAAAGCGCAA
ATGACTAAGGACTTCTTTTATATATATCGTTTCACCATGT
ACCAGTCTCTGTTACATGTTTTACAGAGTCACATGGAACA
TTTCAGCTATTGTGATGCCTATATAGTTATTATAATTATC
TGAACATCATGCATATCTTCCTTGTAAATTTTGAGTTTTG
CATTTTATTTATTCTAGCTTTTTCATTTGTCGTCATGATG
GATTTCGTTCATGTGCGTTCCCAGAGACTGCTACAGTTCA
CATAGAATATATTTTTGTTAATACCTATTAAAATGGGGAG
CTACTCCTTTCCTTAAGCTGGAGATTTAGGTTGACTATAA
TATAAATTACAGTGTTGGGGGATCGGGTTTGGTGTGCGCT
CCGCTGCCCATTGGATCTTATTTCATGCCATATTGGAAAT
TCCTTTGGACATCACTGCTTTTGCAACAGGACGAGTTGTT
GGACGCACACACCGGCCCGCCCGCCTGCCCTCAGAATGTG
TGTGCACTCCTTCTAAGACTTACTGGATAGTGGAGCTGTC
TGTACAGGTTGGGTGAGAGAATGTTTTGTGTATATGTGTG
TGCGTGTGTATTAGAAGTGGTGCTGGAGTTCTGCTCATGC
CAATGCCATATTGAGCAGCGTTTCACTTATGAACTGTATG
GCGCAGTGAAACAACAGAACATGAGAGGCGTGTGTGCCAC
TGATATTACCATTTTTGTCCTTCAGTACCACTCCTTATTT
TCCTCCACCTCCAGAATTTCCTTTGCGCTGAACTTTGGGA
GCTTAATTTGAATATTTTGTACTGTACAAAGGAAACACAA
ACTGTGGACTTAATACTTTTTTTTAATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations