Transcript

kat2a-202

ID
ZDB-TSCRIPT-131113-12
Name
kat2a-202
Previous Names
  • kat2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022051 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022051|OTTDARG00000018224|ZDB-GENE-080403-11 kat2a|OTTDARP00000018516 kat2a-001 LG_ BX005093.22 Danio rerio protein_coding KNOWN, 1758 bp
GGAGATCCGTAGGGGGGAAGTGAGTGAGCACGGAGATCCG
TAGGGGAAGTGTGGCTGCTGTTATGGCGGACCCGGCGGCA
CAGAGCTCCGCGCAGCCCCGGCTTCAGCAAGCGCAGTCCA
GCGGCCCGACCGGCTCCAACTCGAACCCCGGAGCCGGGAG
CAGCGACCCGGCCCGACCGGGCCTAAGCCAACAGCAATGG
TCCAGCCAGAAGAAAGCCCAAGTCCGTTCGTTTCCGCGGG
CGAAAAAGCTGGAGAAACTCGGAGTGTTTTCATCCTGCAA
GGCGAATGATGCTTGCAAGTGCAATGGCTGGAAAAACCCC
AATCCACCAACAGCGGCTCGTATGGAGCTCCAGCAGCAGG
CCGCCAGTCTGACGGAGACCTGCCGAAGCTGTGGACACTC
TTTGGCGGAGCATGTGTCCCACCTGGAAAACGTGTCTGAG
GAGGAGATTAACCGGCTGTTGGGGATGGTGGTGGATGTGG
AGAATCTCTTCATGTCTGTCCATAAAGAAGAAGACACGGA
CACCAAGCAAGTCTACTTTTATTTGTTTAAGCTGCTGAGG
AAGTGTATTCTGCAGATGGGGAAACCAGTGGTGGAGGGCT
CTCTCGGTAGCCCTCCTTTCGAAAAACCCAACATAGAGCA
GGGGGTGTTGAACTTTGTTCAGTATAAGTTCAGTCATTTG
GCTCCTAAAGAGAGGCAGACCATGTATGAGCTCAGTAAGA
TGTTTCTCCTCTGTCTGAACTACTGGAAGCTGGAGACACC
GTCACAGTTTCGGCAGAGGGCTCAGAAAGAGGACGCAGCG
GCATACAAAGTCGATTATACTAGGTGGCTGTGTTACTGTC
ACGTTCCTCAGAGCAATGACAGCTTGCCACGGTATGAGAC
CTGTCAGGTGTTCGGCCGCAGTTTGCTGAAGTCCATCTTC
ACTGTCACCCGCAGACAGTTACTGGAGAAGTTCAGAGTGG
AGAAAGACAAACTGCCGCCAGAGAAACGCACCCTCATCCT
CACACATTTTCCAAAGTTTCTTTCCATGTTGGAAGAGGAA
ATCTATGGAGAAAACTCTCCCATCTGGGAGGCAGACTTCA
CCATGCCAGCCTCAGAGGGCACACAACTGGGCCATCAAAC
AGTACTGAGTCCAGTGTCCATCTCCGGCTCTCCTCACAGT
AAGGGCAGCAGCGCCTCTGCTCTGGGTGTTACAGGTTTGG
ACGTAGCTTCCTCTGAACCAACAATCGGTGAGAAGCGAAA
GCTGCCTGAAGCGCTGACTCTGGAGGATGCCAAGCGGATC
CGAGTAATGGGTGATATTCCCATGGAGCTGGTCAATGAAG
TTATGAAGACCATCACAGACCCTGCTGCCATGCTGGGCCC
TGAGACCAGTCTGCTGTCTGCAAACGCAGCTCGCGATGAA
ACGGCTCGTCTGGAGGAGAGGAGAGGCATCATTGAGTTCC
ATGTGATCGGTAACTCGCTCTCTCAGAAGTCAAATAAGAA
GATTCTAATGTGGCTCGTGGGCTTGCAAAATGTTTTCTCC
CATCAGCTTCCCCGCATGCCCAAAGAGTACATCACGCGCC
TTGTGTTTGACCCGAAGCACAAGACGTTGGCTCTGATTAA
AGATGGCCGCGTGATTGGAGGGATCTGCTTTAGGATGTTT
CCCACTCAGGGATTCACAGAGATTGTCTTTTGTGCTGTCA
CCTCCAATGAACAGGTCAAGGGCTACGGGACACATCTGAT
GAATCATCTTAAAGAGTATCACATCAAGCACGGAATTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations