Transcript

flr-201

ID
ZDB-TSCRIPT-120213-929
Name
flr-201
Previous Names
  • flr-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053456 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053456|OTTDARG00000037452|ZDB-GENE-070117-2066 flr|OTTDARP00000042048 flr-001 LG_ BX510989.13 Danio rerio protein_coding NOVEL, 2559 bp
GCTCTGGGAAGCGTCATGTATTGATTACGTCACTTCCGTT
TCTTGGACGGTTGCTAAGCGACATGATGTCTGCGTCGTTC
CACTGAAAACATTCAGCGCTGCATCTTCAACTTTACAAAA
AAAATACGTTTTTGTTTATGGAGTAAAGCTGCATGAAGCG
TTGGGTTCAATAATGCCGCCAATGACGATTAAAGACGGCG
AATACACGGCCACCGTGTACAAAATGATTAAAGAAGGGCG
ATATGGAGACGCAATTCATATCCTGAGCAAAGAACATCAG
AAACACACTAAATCCAGGGCTGCTTTGTCTCTCCTTGGCT
ACTGTTACTATCACATGCAAGACTTCACTAATGCAGCTGA
GTGTTATGAGCAGTTAACACAGCTTCACCCTGAGGTGGAG
GACTACAAACTTTACTACGCCCAGTCTCTATATGGAGCAT
GTGCCTTTCCAGAGGCCATGAAGTCTACTTTTCTCTTGGA
CAACACAACAAGTCATACCAAGATGATCAAACTGCAGGCT
GCAATCAAATATGGAGAGGAAGATTATTCTGGTGCAAAGA
CACTGGTTGAGCAGTTGCCTCAGGAAGATCCAGACTATGA
TGTGGATCTCGGCTGTTTGCTTTATAAGGAAGGCGAGTTT
GAAGAGGCCTGCAAAAAGTTTATGTCCTCCATGAATGTAC
TAGGCTACCAGCCAGATCTGGCATACAATATAGCGCTTTG
TTACTACAGTTTAAAACAGTATGCCTCAGCGCTCAAATAT
ATTGCTGAAATTATTGAACGTGGAATTAGAGAGCATCCGG
AACTGAGTATTGGAATGACGACAGAAGGCATTGATGTAAG
GAGTGTCGGCAACACCCTCATCCTGCACGAGACTGCTTTG
ATTGAAGCCTTTAATCTGAAAGCAGCTATTGAATACCAGC
TAAAGAACTATGCTGCAGCACAGGAAGCACTGACGGACAT
GCCTCCCAGATCAGAAGAGGAATTGGATCCAGTTACTCTT
CACAATCAGGCCTTAATGAACATGGACACCAAACCTACAG
AGGGCTTTGAGAAGCTTGCTTTCCTCCTTCAGCAAAACCC
CTTCCCTCCTGTTACTTTTGGCAACTTACTTTTGCTTTAC
TGTAAATATGAGTACTTTGACCTTGCAGCAGATGTCTTGG
CTGAAAATGCGCATCTCACATACAAGTTTCTTACACCGTA
TCTTTATGAGTTCCTGGATGCCATGATCACATGCCAAACA
GCTCCTGAGGAAGCGTTTCGAAAATTTGACGAAAATGCTG
GGAAACTGACTGAACAGCTCCGCAAGGTTACGAAACAGGT
GCAAGAAGCAAGGCACAACCGAGATGATGAATCCTTAAAA
AAATACGTCCAAGACTATGACGAAGTCCTTGAGAAGTACA
TCCCTGTACTAATGGCACAGGCCAAAATCTACTGGAACCG
TGAAAACTACAGCATGGTGGAAAAGATCTTTCACAAGTCA
CTGGAGTTCTGCAATGAGCACGACACTTGGAAGCTGAATG
TTGCTCATGTGCTCTTCATGCAAGATAACAAATATAAAGA
AGCCATTGGCTTCTATGAGCCCATTGTTAAAAAGCATTAT
GAGAATATCCTCAACGTCAGTGCAATTGTTCTTGCAAACC
TGTGTGTGTCGTACATCATGACCAGCCAAAATGAAGAGGC
AGAGGAACTGATGAGGAAAATAGAGAAAGAAGAAGAGCAG
ATCTCCTATGATGATCCAGACAAAAAAATCTTTCATTTGT
GCATTGTCAACCTTGTAATAGGGACTTTGTATTGTGCTAA
AGGGAATTATGACTTTGGCATTTCCCGAGTCATAAAGAGC
CTTGAGCCATACAACAAAAAGCTTGGAACAGACACATGGT
TCTACGCTAAGAGATGTTTTCTCTCGCTGCTGGAAAACAT
GGCCAAGCACATGATCATGCTCAGAGATTCAGTAGTGCAA
GAGTGCATTCAGTTCCTTGAGCACTGTGAATTGTACGGCA
AAGATGTGCTTGCCATCATAGAGCAACCTCTGGAGGAGGA
TCGCATGCACATTGGCAAGAACACCGTCACGTATGAATCC
CGCCTGATAAAAGCTCTCTTCTATGAAGTCACAGGATGGA
ATGAGTAACCCTTATACATCACGAATATTCAGAGACACAC
AGCGTGGTTTTCTCACTGAAGCTTTAAAGTCTAAATGATG
TCTTGGATAGATGGCAGTTTGACTAATAAGGTATCTCAGC
TTGGCTACTTTTTAAGCGGCTTTTGGGGAGATCACGCTGT
TTCTGGACTGAATTCAAACATGCATTTTTAAGCATGCATT
CATTGTAATAATGAAGCCACAGGGGTTTGCTCCCTCGAAA
CAGGAAAGCTTAACCCATGAGGAAATATTCGACACAGAAG
GGCATCTATTTTTAATTTAAACTAAGCTCTGTTTGCTCTA
AATATTATAAAACATGTCTATTTAACCTTTTAGGTTCTGT
GCATCACAGTCAATGGCATTAAAACTGTACAGTCTAAATA
TTTTTCTTCAGAATAAAAAAGAAAATAGATGGAAATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations