Transcript

birc2-203

ID
ZDB-TSCRIPT-120213-628
Name
birc2-203
Previous Names
  • birc2-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053827 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053827|OTTDARG00000037578|ZDB-GENE-030825-6 birc2|OTTDARP00000042298 birc2-003 LG_ CU695000.9 Danio rerio protein_coding KNOWN, 832 bp
AGGTCACACAGGCATGGAAGGCACCTTTTACTCCCCGAAC
CTCAAGCTCCTCTTCCCCACCGTCCTCGAGGATAGGCAGC
CATCCCGGAGTAGCAGGACTACTGTCCACAGAGCATCTCC
ACCTGAGGACTTTGCCCAGGAGTTCTCAGTAATACAGAAG
CAGTCTAGGAGGTGGAACTCATCAACCAGGCCTGAAAAGT
ACTGCTAAGCCACACATTGGCAGGTTGCTCCCCATTAAAG
ATTCCTGCATCATAGGAGAAGGAAGCACATACATCCCACG
TCAGCATTCTGTTTGTTCAAGATTTAATAAATTTTTTTAA
TAAGGTCATGTATTCTACCATGGACGACTAGACCCCATTC
AGGGGATGTCCAGCAGAGAGAAAGATTTGAATGGATACAC
CCTGTGGTCACATTTTAGTGTTTGTATGTTAGATTTCTTA
CTAATATGTTACACTTCAAAGAAGGCACTTCTTCACTTTT
AAAAATGTGTTTTGGTTTGTGTAATAGTGGTGTATTTCTC
ATTGATAAAGGTTGAGCTTCCAGAGTCTCTAGAATGATCA
TCTAAACGTTAAGTTGTGCATCACATTATGTTCATGCAGT
TTTAGTTCAGGGCACATGTCACCGGTTCTGTGATGAAACC
CAGTTGAGTAACCCACTGTTTTGTAATCCAGGCGTGTTGT
AAGGACATAAAGAGGAGTCTTTTTTTTTTTTTTATAAATG
TTTTCAAAGGTTGTGTAATCTAGTTTGTCTTACTCGCATA
GTTCATCATTAACATCTACATGCGTGCGCACACACACAGG
GTATGACAATCAAGCCTTTCTCTCTGCTGGCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations