Transcript

krit1-003

ID
ZDB-TSCRIPT-120213-1019
Name
krit1-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054013 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054013|OTTDARG00000025954|ZDB-GENE-030131-555 krit1|no_translation krit1-003 LG_ CR855331.14 Danio rerio protein_coding KNOWN, 804 bp
GTCTGCAGCTGAAGCCGTACCACAAGCCCTTGCAGCACTT
ACGGATGTGGAGCGAGATCGTGACGGATCTCACTGCTCTG
GATCCACAGAGAGAAAGTCCACAGCTCTTCCTGCGCAGAG
ACGTTCGGCTGCCTTTAGAGGTCGAGAAAAAGGTTGAAGA
TCCGCTGTCCATCCTCATCCTATTTGATGAAGCTCGTCAC
TGCCTCCTTAAAGGTTTCCTCTCGACGTCAGATAACAAGC
TAATCACGCTCGCAAGCCTCCTCCTGCAGATCATCTACGG
AAACTACGACAGCAAGAAGCACAAACAGGGCTTTCTAAAT
GAGGAAAACCTGAAATCCATAGTTCCCATTTCAAAGGTCA
AGAGCAAAGCACATCACTGGACTAACAGGATACTTCACGA
GTACAAGAGTCTGAGCACTAGTGAGGGTGTGAGTAAAGAA
ATGCATCACCTCCAGAGGCTCTTCCTGCAGAACTGCTGGG
ATATTCCTACTTATGGTGCAGCGTTTTTCACAGGACAGGT
CTTCACTAAAGCCAGCTCCAGCACACACAAGGTGATCCGC
GTGTATGTGGGCGTCAACACCAAAGGCCTGCATCTGATGA
ACATGGAGACAAAAGTGAGACTTCAACCACTCATGGATGC
TTTCACAAAACGGGAAAAATCTAGAGGAGCATAGCAAAAA
TACAGTGTAGTTGAAATTATGTAGTTTGACATTTTTTGCA
ATAACTTTACTTGAGTGACCAAACTGTTTTATTTAAATGA
ACCAACATTTTTCCCTCTATATTCACTGAGAAATTGATTA
AAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations