Transcript

nr1d2a-201

ID
ZDB-TSCRIPT-110325-987
Name
nr1d2a-201
Previous Names
  • nr1d2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047799 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047799|OTTDARG00000033900|ZDB-GENE-040504-1 nr1d2a|OTTDARP00000037523 nr1d2a-001 LG_ CU855686.17 Danio rerio protein_coding KNOWN, 3081 bp
AGGAGGTGTGATAGCTTATGTCTGCTCCTCAAGCTCGGCC
TCCAGCCCTGAGTCCTGCATGAGTGACAGCTCTGCCAGCC
AATCGCCATCCTCCTCTCCTCCTCTGCCCACTAAAGCGAG
CCGTGCCACAGATCTGTCCATCAGCGCAGGAATGCTGAAA
CACACACGTGGACACACATCTGATAAAAGCCTCGCTAACA
AGAGCTCCATCACCAAGCTGAATGGGATGGTGTTGCTGTG
TAAAGTGTGTGGAGACGTCGCCTCTGGCTTCCACTATGGT
GTTCATGCCTGTGAAGGCTGCAAGGGCTTCTTCAGAAGAA
GTATCCAGCAGAATATCCAGTATAAGAAATGCCTGAAGAC
TGAAAGCTGCACTATAGTGAGGATAAACCGCAACCGCTGC
CAACAGTGCCGCTTCAAGAAGTGTTTATCCGTCGGCATGT
CAAGAGACGCCGTGCGTTTCGGACGCATCCCGAAGCGTGA
GAAGCAGCGGATGCTCCTGGAGATGCAGACGGCGATGAAC
AACATGATGAACAACAGTCAGCTCCAGCACATGCTGCACG
TTTCTCCGAGCGACTCGTCCAGCTCTTCTTCTGCATCTCC
GCCGGATTCCCCACGCTCCTCGACGGAGTCGCTCGTCCCG
ATGGACACCGCCTCGTCCTGCTCGTCCGACAGCGGAGAAG
AAGACGGACGATTCTCCTACAGTGCATCTGTTTCCCCGGC
CGCATCTGAAACACTCAGCAGGGAAGAAGAAGAGCCGCAG
ATGCAGTGCTGGAGACGCTCAGACTGTCAAAACACCACAG
GACCTTACAGGGAACAGACGGCGCAGCAGTGCATTCGCTT
ACCGACTGAAAACATGAGTTACTGCAGGAGGAACATGAAT
GAAGGAGGAAACCGAGCACATCTGGTTTGTCCCATGAGCG
CCTCCCCGTTTGTTGACGCCTCCAGACCCGGTCATGAAGT
CTGGGAAGAGTTTTCCAGGAGTTTCATCCCTGCCGTTCGA
GAGGTTGTAGAGTTTGCTAAGCGGATCCCAGGCTTCCAGG
AGCTTTCCCAACACGACCAGGTCAACCTGCTGAAGGCCGG
CACATTTGAGGTGCTGATGGTGCGTTTCGTGCCTCTATTC
GACGTGCAGCAGCGGACTGTGAGTTTCATGAGTGGCAGAA
GGTACAGTGTGGACCTGCTGCGCTCCATGGGGGCCGGAGA
GCTGCTCAACTGCATGTTCGAGTTCAGCGAGAAACTCGCC
GCTCTGCAGCTCAATGACGAGGAAATGAGCCTCTTCTCTG
CTGTGGTGCTCGTGTCTGCAGACCGATCAGCAATTGAGGA
CGTTGTCGGTGTGGAGGCCCTTCAGGAAAGCCTAATCCGA
GCCCTGAGGAACCTAATCATGAAAAACCACTCAAACGAAT
CCTCCGTGTTCACCAAACTGCTCCTAAAACTGCCTGAGCT
GCGATCGCTCAACAACATGCACTCCGAGGAGCTGCTCGCC
TTCAAAATACAACCCTAAACAACCAACCTGCGCTCTCCAT
TTTACTCTTGAATGTATTTAACAGGCTTTTATACTGAATA
ACGACGCATTCGTACGCTATTATTAGATATTGTGATATTT
GCTAATGACGCACAAGCGAAAGCGAAAAACGTTTGTTTTT
TAAAACACATGAAAGACTCTTCCTCTTTTATTTATGTGCA
ATAGCTGCTAACGCATGGCTAGTCGTATAAGAGCAGCTTT
ACGTCGTGTTTGTCCAGAAGAGTTTGTATTGATTAAGGCC
AGACGCTGCAGGCTTTTTAGGCTTTTCATAAATGCCAAGT
AAACATGCACTTAAAAAAAGCATAAAAAATATAAACTTTA
TCTTTTTTTGCACTTTTTGTAAATTTCAGTCACAATACAT
ATTTTAAGACAATACATATTTTACATATTTTTTCATCTCA
ACTAAGCCACAAATTGCTTTTTTAGCACTGTTTATGTACA
TTAAACATCACAGTTTTGCAGGAACTACTTTATCTGTGCA
TTTAAATATCATCACGTTTTAGAATGCTCCAAATTGGCCG
GAACTACTTTATCTGTGCAGTAAATAACATCATGTTTTAG
AATGCTCCAAATTGGCCGGAACTACTTTATCTGTGCATTT
GAATAGCAGTCGACATTTAATTAGCAGTCGATTTTAAAAT
GCTCAAAATCTGCAGGTACTACTTTAAATGTGCATTTAGG
AAACAGCACATTTAAGAATGCCCAAAATCTGCCGGAACTA
CTTTGTCTGTGCATTTAAATAGCAGTCTATTTTAGAATGC
TTAAAATCTGCCGGAACTACTTTATCTGTGCATTTAAGTA
ACAGCACATTTTAGAATTCTCAAAATTGGCCGGAACTACT
TTATCTGTGCATTTAAAAAGCAGCACATTTTAAATGCTAA
AAATTGGCCAGAATTAATTTATCTGTGCATTTAAATAGCA
GTCGATTTTAGAATACTCAAAATTGGCCAGAACTACTTTA
TTTGTGCATTTAAACAGCAGCACATTTAAGAATGCTCAAA
ATTGGCCGGCACTAATTTATCTATGCATTTTAAACAGCAG
CACATTTTAGATTGCTCAAAATCGGCCAGAACTACTTTAT
CTGTGCATTTAAATAGCAGTTGATTTTTGAATGCTCAAAA
TCTGCCGGGACTACTTTATCTGTGCATTTAAATAACAGCA
CATTTTAGAAAGCCTAAAATTTGCCGGAACTACTTTATCT
GTGTATTTAAATAATAACACATTATAGAATGCGCTAAATC
TGCCGGAACTACTTTCTCTTTGTATTTTAATAATAGTACA
TTATAAAATGCGCTAAATCTGCGGGAACTACTTTATCTGT
GCATTTAAATAGCAGTTGATTTTAGAATGCTCAAAATGGT
CTGGAACTAATTCATTTGTGCAATTAAACAGCAGCACATT
TTAAAATGCTCAAAATCTGCCAGAACTACTTCATCTGTGG
ATTCAAATCATAGCACATTTTAGAATGCCCATCAGCCAAT
CAGAAGCAAGCATTCAACAGCCCTGTAGTATAATGATAGC
TTTTTATTTTTAACCCTTTTTTTCGCCTGCAGTGTCTAGC
C

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations