Transcript

trip13-201

ID
ZDB-TSCRIPT-110325-983
Name
trip13-201
Previous Names
  • trip13-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047769 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047769|OTTDARG00000033880|ZDB-GENE-040426-1488 trip13|OTTDARP00000037499 trip13-001 LG_ CU463028.9 Danio rerio protein_coding KNOWN, 1718 bp
CCGGTTTCAGGCGGCGCCTCTTCCGGGGCAGCCTGACGTC
AGTGTGAGCGCGGTAAGTTCGAGCTCGTCGGTCAATCTCT
GAGGTGAGAGTTTTTCCATCAGTAATGGACATCTCTGACC
ATCACATGACTGATGTTGGCATCATCCGTCCTGATGTGCA
CATAGAGGTTCATGTCAAATCTCAGAGCACAGCGAAGCGC
TCTGATGTGAGGACGCATGTGTTGTCTCTGCTGGATCGAC
ACAGCACAGTTTTAAGGTCTTTCAAGTGGACAGATTTTGA
TGATGAGTTTCTTGCCAAAAATGTGGAGTCAGTCACTATA
GCAGACGTAACTGGCCCGAAACTTGTGGATCTGAAGGTTC
ACAACCTCTGCATCCATATTTTCACTCTGAATGATGACAG
TCCGAGCACGCTCAATCTGGAGGAGGAGGAGGAGCTTTCT
GCTGCCAATCTTTGGCTCCTCCCAGCAGTTGAATTTCATG
GCGTTTGGGAAAGCTTGATTTATGAGGAAGGCATCAAAAC
ACAACTCTTGGATTATGTTTCCACAACAATTTTCTTCTCT
GACAAAAATGTCGACAGCAATTTGATCGCCTGGAATCGTG
TCGTATTACTTCACGGGCCGCCTGGCACAGGGAAGACGTC
TCTCTGTAAAGGACTTGCCCAGAAACTCTCCATCAGACTG
TCTGACAGGTATGCACACAGCCAGTTTGTGGAGATCAACA
GCCACAGTCTCTTCTCCAAGTGGTTCTCGGAGAGTGGAAA
ACTGGTGACGAAGATGTTCCAGAAGATTCAGGAGCTCATT
GATGATAAAGATGCCCTGGTGTTCGTCCTAATAGACGAGG
TGGAGAGTCTCACAGCGGCCCGAAGTGCTGCTCAGGCAGG
AACGGAGCCGTCTGACGCTATTAGGGTGGTCAATTCTGTC
CTGACCCAACTCGACCAGATCAAACGCCACCCAAATGTGG
TCATCCTCACTACATCCAACGTCACAGAAAAGATTGATCT
GGCGTTTGTGGACAGAGCTGACATAAAGCAGTACATCGGC
CCACCGAGCGCCAAAGCCATATTCAACATCTATCTGTCCA
GTCTGGAGGAGCTCATGAAGCGTCAGATCATCTACCCCAG
ACAGCAGCTGGTGAGTTTGGAGGAACTGGAAACCATGAAC
TTCATGGAGAGCGACGTGACCCGCCTGAGCTTATGTCTGA
TGAACATCTCTCAGAGGAGTGTGGGACTCAGTGGAAGAGC
CTTGAGGAAAATCCCATTCCTGGCTCATGCGCTGTATGGA
AAGACCTCTACAATGACGCTGAAGGGTTTTCTGACAGCGA
TGGAGCACGCTGTGGACAAACAGAGGCAGGAGCAGGCGAG
TTTGGTCAACTGTGTCTGAGCTAAATCACACTGATGTTCT
GCTGTTGCATCCAAAACGTTTCTTGTCCAGTTTTTTCCTC
AGTATTAATGGTCCGTTCACCACCGTTCACCTGTTTCTGC
TGTCCTACAACAAACCAGCGTTGTTTTATTTCACATCTCA
GTGTTTAAAACAGCACTTATCCACATCACACTGTAATTTT
CTAGGAGATTTTTGTCCATTCACTATTGATGAGCTGCAGT
TTTGATGTCTGACTTTGGCAATGGCACTTCTATTTGCATA
TCAAACAATGTTCTTTTTATGTTTAGGTTTTTATATGTGT
ATATATTTAAATAATCTGATTAAAATCAGGGGAAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations