Transcript

hps5-002

ID
ZDB-TSCRIPT-110325-899
Name
hps5-002
Previous Names
  • ch211-112d9.2-002
  • zgc:162420-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051141 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051141|OTTDARG00000035886|ZDB-GENE-070410-80 hps5|no_translation CH211-112D9.2-002 LG_ CU184832.20 Danio rerio protein_coding KNOWN, 486 bp
AGCGGGCACAAACACACACGACCATCAGTTTACACACTAT
ATGACTCGTTTTTACTACGTTTCTGGATATTTCGCCGATT
TAAATGCGTCTGGAGCTCAGGAGGAGACCGGTGCAGGATG
ATTCCTGTGGTTCCTGTGGAGTCCTGCACTCACGTCCTGG
CAGAGTTTGACTGTCTGGACCCCCTGCTTTCTGCCCTGCG
ACTGGACTCCGGACGCATCAAAGTAAACCGCACATTTACC
GCCACAGTTTACTGTTGTGATAAGTTTTTATGGCGATCGC
TTTGGGTTATTCAAACTGACCTGAATCGCAGTTTGTGTTG
TTTACCTTTCAGCGAGCGTTTCTCAGTTTCTGTTCTGTTT
ATTTGATTTCCTGCTGTAAGAAATATTCCACGAATGATTG
AATCTGACAGACATAGTTGGGTCTTAACAGTTAAACAAAA
AAAATCATAAGTCCAAGGCACTTGAAAAGTAATTATTAAT
ATTCCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations