Transcript

aco2-201

ID
ZDB-TSCRIPT-110325-795
Name
aco2-201
Previous Names
  • aco2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050702 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050702|OTTDARG00000035608|ZDB-GENE-030131-1390 aco2|OTTDARP00000039813 aco2-001 LG_none CU462845.5,BX000473.6 Danio rerio protein_coding KNOWN, 3495 bp
GTCACATCTTTGTCAGTGAACAAAATGGCAACCTACTGCT
TAACTGTCGCCCGGCTTCAGCTCGCTCTGGGTCAGGGTTC
CCGCCGTTTTCATGTGGCGGCGGCTCTCAACGCAAAGGCC
AAGGTGGCCATGAGCCGCTTTGAGCCAAGCTCTTACATCA
ACTATGACAAGCTGCGTTCAAATATTGACATCGTGCGTAA
AAGACTCAATCGACCGCTCACCCTGTCAGAGAAGATTGTG
TATGGCCATCTTGATGACCCGGCTGGACAGGAAATTGCTC
GAGGACGCACATATTTGCGCCTGCGACCCGATCGGGTTGC
TATGCAAGATGCAACAGCACAGATGGCCATGCTGCAGTTC
ATCAGCAGTGGACTCCCAAAAGTGGCAGTGCCGTCCACCA
TCCACTGTGACCATCTTATTGAGGCCCAGACTGGAGGAGC
TCAAGATCTGCAGAAGGCCAAGGAAGTGAATCAAGAGGTT
TATAGTTTCCTTGCTAGTGCTGGGGCTAAATATGGTGTGG
GTTTCTGGAAACCCGGTTCTGGGATCATTCATCAGATCAT
CTTGGAAAACTATGCATACCCAGGAGTCATGTTGATTGGT
ACAGACTCTCACACCCCTAACGGCGGGGGTTTGGGCTGCA
TCTGCATTGGAGTTGGTGGAGCTGATGCTGTTGATGTCAT
GGCAGGCATTCCCTGGGAGTTGAAATGTCCAAATGTCATT
GGTGTGAAGCTGACAGGCTCATTATCTGGTTGGAGCTCAC
CAAAGGATGTCATCCTGAAAGTTGCTGGTATTTTGACTGT
GAAGGGTGGCACTGGTGCCATTGTGGAGTATCATGGCCCT
GGTGTGGACTCCATCTCATGCACAGGAATGGCCACAATTT
GCAATATGGGTGCTGAAATTGGAGCTACCACCTCGGTGTT
CCCTTTCAACCACCGTATGAAGACATACTTGGACAAGACG
GGTCGAGGAGAAATTGCCACTTTAGCAGATGAGAACAAGG
ACTTATTGGTTCCTGACTCGGGTTGTCATTATGACCAGCT
GATTGAGATTAATCTAGATGAGCTGAAGCCTCACATCAAT
GGCCCATTTACTCCTGACCTGGCCCATCCTGTTTCGGACA
TCGGCTCTGTTGCTGAGAAGAATGGTTGGCCCCTGGATGT
TAAAGTTGGTTTAATTGGAAGCTGCACCAACTCCAGCTAT
GAGGACATGGGCAGAGCCGCTTCCCTGGCCAAACAAGCAC
TCGACAAGGGTCTCAAGTGCAAAGCCCAGTTCACTGTCAC
TCCTGGGTCAGAGCAGATTCGTGCCACAATTGAGCGAGAT
GGCTATGCTAAAGTGTTGAGAGATGTTGGTGGAATTGTCC
TGGCTAATGCCTGTGGACCTTGCATCGGTCAATGGGACAG
ACGTGACGTTAAAAAAGGAGAGAAGAACACCATTGTTACA
TCATTCAACAGGAACTTTACAGCCAGAAATGATGCCAACC
CTGCAACTCATGCTTTTGTCACCTCTCCAGAGATTGTCAC
AGCCCTTGCTATTGCAGGCACACTGAAGTTCAACCCTGAG
ACTGACTATCTCACAGCCCCCAATGGAGAGAAGTTTAAAC
TGGAGCCGCCCACAGGAGATGAACTTCCTGCTCGTGACTT
TGACCCAGGTCAGGACACCTATCAGCATCCACCAGCTGAT
GGCTCTGCTCTTAAAGTAGATGTTAACCCACAAAGCAACC
GTCTGCAGCTGCTCGAGCCCTTTGACAAATGGAATGGAAA
AGACCTTGAGGACCTCCAAGTGCTCATCAAGGTGAAAGGA
AAGTGCACCACTGACCACATCAGCGCTGCCGGACCCTGGC
TGAAGTTCCGTGGCCACCTTGATAATATTTCCAATAACCT
GCTCATTGGTGCTGTTAATATCGAGAATGATGGTGTCAAT
AAGCTTCGCAACCTTCTGACTGGGGAGTACAGTGGTGTTC
CTGATGTTGCTCGCCATTACAAAAAGAACAACATTTCGTG
GGTAGTTGTGGGAGATGAGAACTATGGTGAGGGATCCAGC
AGAGAACATGCTGCTCTGGAGCCCAGACATTTAGGAGGGA
GGGCCATCATTGTGAAGAGCTTTGCTAGAATCCATGAAAC
AAACTTGAAGAAACAGGGCCTGCTGCCCCTCACCTTCTCC
AATCCTGCTGATTACGACAAAATCCGCCCAGATGATAAAA
TCTCCATTATAGGGCTTAAGAGCTTTGCCCCTGGAAAGCC
TCTTAAAGCCGTCATCAAGCACACCGATGGAAGCTCAGAA
ACAATTGAGTTGAACCACACCTTTAACGAAACCCAGATTG
AATGGTTCCAGGCTGGCTCCGCCCTCAACAGAATGAAAGA
GATGCAGAAATGAACGTGATTGGCCATAAATATACATATA
TGTGAGGGGGGAGGGGTTATGCATCAAACAGGAGCATTGG
AATGTGTATGAAAGGTTTAAACACTCATGTAATTATGAAC
TAAAGTATACACAATACATACAATACATTTTTAAAACTGT
GTTACATAGACAAGTCATGTCGATACACAAACATCTCAGA
TCTATATAATATATTGCAGGACTGATAATTGTTTAGAAAT
TGTTATGCTTAGTGCAAGTTTGAAACTATTACAGGATGGT
GAAAAATAGCCTACAAATGATTTTAACGGAAGACGCCGGA
GTTTGATTTACAAAATGATCCAAGTATCTGTGCTGTGATC
AGACAACTGTTTATGATTCATTTCTGTTTGTAATCTCACA
CTGAACTGTAATGAGAGCTGCTTGTGAATTTTCTCTGCTG
TAATCAGCCGATATTTGACTTGATTCTTTTAACAAAGCTT
GTCAGTCACTCATAATAATTGGTGTACTTATTGACGCAAG
CTTGAAACTTGACCGGTTATTGTTCATGTAGCTATTCTGA
CTTGTCTATGCCTGTTCTTCAAATCTTCTGCAGATCTCGT
CATACACAACATCAAAATCAATCAATTGTTCCTGTGCTGA
GCGCACCGCAGGTCAAGTTCTAAATGTTTTAAACCGAATT
CATATTTATAAGCATTTGAAGCGATTCTCGAATGTGCATT
ATCTTAAGTGTTTTGGATGACAGTTCTTGAGTAATTGATC
AGTAATCAAACCTTCAGCCTCGTGAGCACTTTTCCTGTAT
ATTTGAGTGCCCTTTTTTGTAGGGTTGCATTTTTTTCTTC
TTTTACACAGAGCTGTTCTCATGTCCGTCAGCAGACAATA
CCAACTTGTTTCAAGATACCAAACAGTATGTGCTCACCAG
ATGACTTTTACTGTAGTACGAATGCTAGCCAATATGGTAA
ATGTGAAGAATACTGTCTTTTTGTATCTGCAGCTCTAAAC
TGTGTAACTCGTAACCACACAAGCACATCCTCTTTATAAC
CCCATTATTTTCCATCTTTTTCTTCTTTTCTGTTCTTGAG
GAAATGGATGCTGATCAGTCACAGTGGGTTATAAAATAAA
GTCATTTAAAATAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations