Transcript

flot2a-201

ID
ZDB-TSCRIPT-110325-637
Name
flot2a-201
Previous Names
  • flot2a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049959 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049959|OTTDARG00000035146|ZDB-GENE-020430-3 flot2a|OTTDARP00000039206 flot2a-002 LG_ BX323596.9 Danio rerio protein_coding NOVEL, 2014 bp
GGTTCAGTCGTCGTCATATCTCTGAAAGGGCGGTGCTGCA
TTCATACGAGGCGAGCAGAAATCTTGACTATGGTGTACGC
ACGACTGCATTGAGTGCCCTCATATCTGCTAGTTTTATTA
CGCTGTTCCGTCGTCCTCGAATAAGGGAAATAACATTAGG
TCTTTAGCCGCTTTTTAAAGGCGTCCAGAAAGGAAAATGG
GGAATTGCTACACGGTAGGACCGAACGAAGCCCTGGTAGT
ATCAGGTGGCTGCTGTGGCTCTGATGGGAAGACGTATACA
GTGGGCGGCTGGGCCTGGGCATGGTGGCTTATCACCGACA
TACAGAAGATAACCCTTGAGATTATGACCCTGCAACCCAA
GTGTGAGGATGTAGAGACAGCGGAGGGGGTAGCTATTACT
GTCACAGGTGTGGCACAGGTGAAGGTTATGACCGACAATG
AACTGCTGGGTTATGCCTGTGAACAGTTCCTGGGCAAGAC
CGTGACAGAGATTAAAAGTGTCATTCTGCAGACGCTGGAA
GGTCATCTGCGCTCTATTCTGGGGACTCTGACGGTGGAGC
AGATCTACCAGGACAGGGATCAGTTTGCCAAGCTGGTGAG
GGAGGTGGCAGCACCTGACGTGGGCAGGATGGGTATTGAG
ATCCTGAGCTTTACTATTAAGGATGTTTATGATAAGGTGG
ACTATTTGAGCTCTTTGGGCAAATCCCAGACTGCAGCTGT
TCAGAGAGATGCTGACATTGGTGTGGCTGAAGCAGAGAGA
GATGCTGGAATCAGGGAAGCTGAATGTAAGAAGGAGATGA
TGGATATAAAATTCCAAGCCGACACAAAAATGGCAGACTC
CAAGAGGGAGCTGGAGATGCAGAAAGCTGCCTTTAATCAA
GAAGTGAACACAAAGAAAGCTGAGGCTCAGCTGGCCTATG
AGCTTCAGGCTGCCAAGGAGCAGCAGAAGATCCGTCTGGA
GGAGATTGAGATTGAGGTGGTCCAGAGAAAAAAGCAGATC
TCTATTGAGGAGAAGGAGATCCTCAGGACGGATAAAGAGC
TGATCGCCACTGTGAGGAGACCAGCTGAGGCTGAAGCCTT
CAAGATGGAGCAGCTCGCAGAGGCAAAGAAGATAAAGAAA
GTGTTGACGGCACAGGCTGAAGCAGAGAAAATCAAACGCA
TTGGAGAAGCAGAGGCCGGTTCGATTGAGGCTGTGGGTAA
AGCTGAAGCAGAGAAGATGAGGCTCAAAGCTGAGGCCTAT
CAGCAGTACGGGGAGGCTGCAAAAACTGCCCTCGTCCTGG
AGGCTCTGCCAAAGATTGCAGGAAAGGTGGCAGCACCCTT
GGGCCGCACCAATGAGATCGTGATCCTGAGTGGCGATGGT
GGTCGTGTCACTGGAGAAGTGAACCGTCTGCTGGCTGAAC
TGCCGGTTTCAGTAAACGCCCTCACAGGGGTGGATCTGTC
CAAGATCCCTTTGCTGCAGAAAATGACGAACCCTCAAGCT
TGAACAGGCTTTTTCCACTGCTGCCTCTACAGCCCTTCCA
CACTGATTGCCTTGAAAAGAAACACTTGAAAGCTGTTTTC
TTTTTGCAGAAATGAGCAACTGTTTTGTTGTTTTTTATTA
GACCCCTGGTGCCTTTCCTCTACAGGACCAGATTCCCTAC
GTGTGCTGTTCTTTTATCACTTGTGTCTTTTTTCAGTCTG
TTTATCAGCCTCGTTTTTTGTTTAAACAACGTTACCTCAG
TCATGACTGTTTGTTTAATCACAGAAAGGTTTCAAAACTC
TTTATTGGGCAGCTGTATCTATGTGTATGTAGTGATATAG
AAAAGGAAGTCCAACCATTTTGATGGGTGGCTACGATTGT
AATCATAGTTACATGTATGCAATGTATTAAGTATAGTGTA
AAAGAGCCATTACGTTTGTAACGCATGTTTAGTGGATTGA
TTAACTGCTCCTTTGAAATTGTGAGAACTTTGCTGTTCAG
GACTAAAGGAAAACTGACTTTTGTTTGATCTAACCCACAC
ATTTAGATGTATTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations