Transcript

rxrga-001

ID
ZDB-TSCRIPT-110325-428
Name
rxrga-001
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049161 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049161|OTTDARG00000034691|ZDB-GENE-980526-36 rxrga|no_translation rxrga-001 LG_ CU855759.9 Danio rerio processed_transcript KNOWN, 99 bp
GCCGTCCAGGACGGCGAAACGAGACAGTTTGCCACTAAAC
TGGACACTTCTTTCATATTCGTCCAAACATGGATAATAAC
GACACATATCTCCATCTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations