Transcript

uxs1-201

ID
ZDB-TSCRIPT-110325-1900
Name
uxs1-201
Previous Names
  • uxs1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047820 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047820|OTTDARG00000033910|ZDB-GENE-020419-37 uxs1|OTTDARP00000037537 uxs1-001 LG_none FP102050.2,CU855778.12,CU639407.4 Danio rerio protein_coding KNOWN, 2432 bp
AGCGGAATCATCGCTTATGTTATCCTGCTCCGAGAAGCTG
ATATGGAGTCGCTTTATTATATTTAAGACACTGCTGGACT
CTTGATTAATAATACTGGATTATCAATCAACCTTGACCGT
TGGACAAGGGAGGATTTAATCAGAAGCGATTGTTATTGCG
TAGCATTTTAGTAACTTGGATAGTTAGCATCTCTAAGCTG
CAAGTCTAGAGCCATGTCGCTAAATTGCTAAAGGACACAT
TTCATATCTAACGTTACCCACCAAAATGCCGTTTTTCTTC
CTTTAACCGATAAGCTTGGATTCATCTGCACTAAAGCCGA
AAATAAACTGCCCAGACTACTTTAACTGTCGGATGCTTTT
TGACGCAGTAATAGTTAGTAAATAAGTTAGCATTGCTAGC
ATAGTAGTGCAGCCGCTGTTCAAATAGAAACTTCCGTCTT
GCACTACGAAAGTCCGTTATCGTATGTTTTTGGGGCTGTA
AACCCGAAGCGAGTCTTCCTCGTGTTTTATTTGCAAGTAT
CAGGCTTGAATGTGAACTAGCGTGAGATGCGGTGGTAAAG
AAGAGTTCGATGCCGTGTGTGCTGGAGGATGATGCGGATG
AGCTGGATGGTCACAGTCATTAACAGAAGAATGATGAAGA
TCCTGATCGCCCTCGCTCTCATTGCGTACATCGCCTCTGT
CTGGGGAACATACGCAAATATGAGGTCTATACAGGAACAC
GGAGAAATGAAGATTGAGCAGAGGATAGATGAGGCAGTGG
GACCTCTCAGGGAGAAGATACGGGAACTCGAGCTTAGTTT
TACCCAGAAGTACCCACCAGTGAAATTCTTATCCGAGAAG
GACCGAAAGAGGATTTTGATCACCGGTGGGGCAGGATTCG
TGGGCTCCCACCTCACCGATAAGCTGATGATGGATGGTCA
TGAGGTGACTGTGGTGGATAATTTCTTCACCGGTCGCAAG
CGCAATGTAGAGCACTGGATTGGCCATGAGAACTTCGAGC
TCATCAACCATGATGTGGTGGAGCCGCTCTATATTGAAGT
TGACCAGATATATCATTTGGCCTCGCCTGCATCGCCACCG
AACTACATGTACAATCCGATCAAGACACTAAAAACAAATA
CTATTGGTACTCTCAACATGCTAGGATTGGCCAAGCGGGT
TGGAGCGCGCCTGCTTCTTGCCTCCACGTCAGAAGTGTAC
GGAGACCCAGAGGTGCACCCCCAAAATGAGGACTACTGGG
GTCACGTGAATCCAATTGGTCCCCGGGCCTGTTATGATGA
AGGAAAGCGTGTTGCTGAGACTATGTGTTATGCCTACATG
AAACAGGAAGGAGTGGAGGTGCGAGTGGCTCGCATCTTCA
ACACCTTCGGGTCTCGCATGCACATGAACGACGGGCGAGT
GGTCAGCAATTTCATCCTGCAGGCTTTGCAAGGAGAGGCA
CTGACGGTCTACGGTTCAGGGTCTCAAACAAGAGCTTTCC
AATATGTGAGTGACCTGGTGAATGGACTGGTGTCTCTGAT
GAACAGTAACATCAGTAGCCCTGTTAACCTGGGAAATCCA
GAGGAACACACCATCTTGGAGTTTGCGCAGCTCATCAAGA
GTCTAGTTGCGAGCCGCAGTCATATTCAGTTCCTTCCAGA
AGCGCAGGATGATCCACAGAGGAGACGGCCCGACATCCGC
AAGGCCAAACTGCTGCTGGGCTGGGAACCTGTGGTCCCAC
TGGAGGAAGGCTTGAACAAAACCATCCAGTACTTCAGCCG
AGAGCTGGAGCATCAAGCCAACAATCAGTACATCCCCAAA
CCCAAAGCTGCCCGCATGAAGAAAGGAAGACCCAGACACA
ACTGAAGACACGGCTTCATCTCAGGGATGCTGGGATATGG
AGGACTTCAGACATCCGGCAGCCACTTTACCAACTCCCAC
TAACAGATGCGTCGTTTTGGCAGAGAGGGGATAAGAGAAG
TTTTTCTGATGTTTTTCAGTCGTATGTGCCTCAAAATGAT
CCAATTTACAGACTTTGCCTTGCACTTTGGTTTGTGAGTC
GTCTGTCTGTCTGTGTGTGTGTCTGTTATTTAAAGCAAGC
TTAGGTCTTCATGTGCGTTATGTTTACATTCTGTGCTGTT
TTAATTGATGTGATCAGTTTTTTTTTCTAGGATTATCATT
GAAGCTAAAGGTGTTTTCGTTTTTTTTAAGGACACCTGTT
GAAAATCAGAAGATTGAGAATTATTTAAAGTGTGTTTTGG
TGCCAGGAAGTCTCAGTTCTGAGGACACGGATGAAAGATA
AGCTTTGAAAAATGTTTCTTTCTGCTTTAATCTTTGTGAC
AATTTCGAGCGAAAATCTGTTGTTACCTTTGTGAAACTTC
ATACAGATCTTATAATGGATTTCAGGTGAAAAGAATATTT
TAATAAAATATTTACTGTGAGTTTTTACTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations