Transcript

nrip1b-002

ID
ZDB-TSCRIPT-110325-1743
Name
nrip1b-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050877 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050877|OTTDARG00000035723|ZDB-GENE-030131-4173 nrip1b|no_translation nrip1b-002 LG_ CU914480.4 Danio rerio protein_coding KNOWN, 195 bp
AGACAGACTCAGTCCCGACGGTCGCTTTTGGAGCCCGATG
AGTTTTTGGACTCTACTTCCATTCGGCGCGGTTGACGGCG
CACGTTTACCCGCAGAAAGCGCTCGGATAGCGGATTCAGT
GGGCTGTATGGTGTCCTGAACGGGTGTTCCTGCGCTAATC
TGCTGAATTCCAGCAACGCTGAGGAGAAACGGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations