Transcript

rpl36-202

ID
ZDB-TSCRIPT-110325-1331
Name
rpl36-202
Previous Names
  • rpl36-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049147 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049147|OTTDARG00000034684|ZDB-GENE-040622-2 rpl36|OTTDARP00000038567 rpl36-001 LG_none CU550710.4,CU633983.6 Danio rerio protein_coding KNOWN, 702 bp
GTCGCGTGTGAAAGTTCAGCTTCCGCCTGACAGCGGTCCT
TCCGGTTTGGACGCCATTAGCAAAGAGCAGAGATGGTTGT
CAGATATCCTATGGCGGTTGGCCTTAATAAAGGCCATAAG
GTGACCAAGAATGTGTCCAAGCCCAAACACAGTCGCAGGA
GAGGGCGTCTGACCAAACACGCTAAGTTTGCGCGTGACTT
GATTCGTGAAGTGTGTGGTTTCGCACCCTACGAGAGACGC
GCCATGGAGTTGCTGAAAGTGTCCAAGGATAAACGTGCTC
TCAAGTTCATCAAGAAAAGGGTGGGAACTCACATCCGCGC
TAAGAGAAAGAGGGAAGAGCTCAGCAACACACTGGCCGCC
ATGAGGAAAGCTGCTGCCAAGAAAGAGTAGCCTGTGTAAT
CATCAAAAATAAAATTGTTTGTGTAAAAACGAGTATTTTT
GACTCTTGTGCTTGATTTAAATGTTTGCTGTTCATGTTGG
AGCGTACAGAAGTGTGTTTGATCAAATACAGGTTGCTGGA
GTAAATATACGAGATGTGTGGCATCTAAACATTCATTATA
AATTTAAATATAATGAATAAACTGCTGTCTCTGAAAACGC
TTTTACCTGAAAAAAATACTACAATATTAATAAACAAAAA
ACAATTATTTATGAATATTAATAATAAAGCGATACATTTT
TAACAGTTTTAAGTAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations