Transcript

rxrbb-002

ID
ZDB-TSCRIPT-100915-1139
Name
rxrbb-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045215 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045215|OTTDARG00000032381|ZDB-GENE-990415-242 rxrbb|no_translation rxrbb-002 LG_ FP067425.8 Danio rerio protein_coding KNOWN, 732 bp
AAACTGAAAATATAGACGAAACCATGCATTAAAGGACACG
AATCGTTGCTGTTGGAGGATTCGGCGTTTGTTGGAAGATA
ATCAAAGATCAACAGTCTCCCCTGTATTGGCCAGTCTAGT
GTGCATCTATGAACTCCTTACCGCCCTCCACTTCTGCCGT
CAGTAGCCCTGTCAGCTCCGTAGATTCGCCACTGTCAGCC
GTCAGCTCGTCCATCGGCTCTCCTGGCGTTCCCGGCACCC
CATCCATCGGATATGGACCCATCAGCAACTCTCAAATAAA
CTCCTCGATGTCGGTGTCTGCATTACATGCTGTCAGCAGC
TCTGATGATGTGAAACCCCCCTTTGGCTTAAAGTCTGTCA
GTGGCTCTGGGCCAATGCTCTCCCAGAAACGCATGTGTGC
AATTTGTGGGGACCGATCTTCGGGGAAGCATTATGGCGTG
TACAGCTGTGAAGGCTGCAAGGGTTTCTTCAAACGCACAG
TCAGAAAGGACCTGAGCTACACCTGCAGGGACAACAAGGA
GTGTCTGGTTGATAAACGTCAGCGCAATCGTTGCCAGTAC
TGCCGCTATCAGAAGTGCCTGGCCATGGGAATGAAAAGAG
AGGGTGGGTACCTGTCAGTCTTTCACTGAAGACACATCAC
CTGTAACATGATGAACTAGGTCAGCTCTCTAAATTATAGG
TGGAGCCATGTAAAAGCAGTGTCATTTAATAAAAATAGTG
TGTTCTTAATGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations