Transcript

rxrab-201

ID
ZDB-TSCRIPT-100915-1124
Name
rxrab-201
Previous Names
  • rxrab-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045109 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045109|OTTDARG00000032322|ZDB-GENE-990415-243 rxrab|OTTDARP00000035659 rxrab-001 LG_ FP016250.10 Danio rerio protein_coding KNOWN, 1721 bp
AGAACCCGTTTAAGATTGATCATGCCACTGAACAGGACAT
GTCAAACCGGTCATGCCTGTACCTGAACAGAAGCAGACAG
TACAGCTCAGTTCCCCCATGAATGCAGTCAGTAGTTCAGA
GGACATTAAACCTCCTCTTGGTCTGAACGGAGTGATGAAG
GTCCCGGCGCAGCCCATAGGAACCCTATCCCTGTCCCTCA
CCAAACACATCTGTGCCATTTGCGGAGACCGTTCATCAGG
TAAACACTACGGGGTGTACAGCTGTGAGGGCTGTAAGGGC
TTCTTCAAGAGGACGGTCAGAAAGGACCTGACGTACACTT
GCAGAGACAACAAGGACTGTATGATCGACAAACGCCAACG
CAACCGATGCCAGTACTGCCGCTATCAGAAGTGCTTAGCC
ATGGGGATGAAGAGAGAAGCAGTTCAGGAGGAGCGTCAGA
GGGCGAAGGAGCGCAGCGAGGCTGAATTCGGCGGCTGTGC
CAACGAGGACATGCCCGTGGAGAAGATTCTGGAGGCCGAA
CTGGCAGTAGAACCAAAGACGGAGACCTATGTGGAGGCCA
ACCTGAGCCCGTCTGCCAATTCTCCGAACGACCCTGTAAC
AAACATCTGCCAAGCAGCTGACAAGCAACTCTTTACCTTA
GTGGAGTGGGCCAAGCGGATACCTCACTTTTCGGACCTCC
CGCTGGACGATCAGGTCATCCTTCTGCGAGCAGGGTGGAA
TGAACTCCTGATTGCTTCTTTTTCGCATCGCTCCATAGCT
GTGAAAGACGGGATATTATTAGCTACAGGCCTTCACGTCC
ATAGAAACAGCGCACATACTGCTGGTGTCGGAGCCATTTT
TGACAGAGTGCTGACAGAGCTTGTGTCAAAGATGAGAGAC
ATGCAAATGGACAAGACTGAACTCGGATGCCTGCGAGCCA
TTGTTCTGTTCAATCCAGATTCAAAAGGATTGTCTAATCC
ATCAGAGGTGGAGGCATTAAGGGAACGAGTGTATGCTTCA
CTAGAGGCCTACTGTAAACACAAATACCCCGATCAGCCTG
GCAGGTTTGCCAAGCTGCTGCTGCGTCTGCCCGCCCTGCG
CTCCATCGGCCTCAAGTGTCTGGAGCATCTCTTTTTCTTC
AAGTTAATTGGAGACACGCCGATCGACACTTTCCTCATGG
AGATGCTGGAGGCGCCGCATCAAATCACATAAACTCCTCA
TGTACGAAACACACGGCAGGAACATTACGCAATGCGCTAA
ATACTGTCCAACCCATTCATTACGGAATACCATGCCGGAT
TAAGTGAGTTTTTCCTGGTTTGCATGCACGTTTGGGAAGT
CTCGCAACGTTCTGGAGTTTTTTTTTTTATTTCTTTTGCC
TTACAGAGGTCTACCTCTGCTTTCCACAGCCGAACCGCCT
CATCTCTGAACTCACAATCATTTTGCTGTGAATGAGAGGA
CACAAAATACCTCAGATGCACTTCTACATGCAGCTGTCCT
TAAAGCGCGCCACTGTGTTGATTTCAGTGGGTACGTTTAC
ATGGTCATGAGTCATCCAATTATTTATCTTCTTCTGAATA
AGGCAATATTATGATTGAGGTGTTTACCTGAGTTGATTTT
AGAATATACCTGTCATGTTCCTGCTTTAGATGTTATAATA
CTAATGCTACGCTCAAGTCCCACTTAAGATGTTTGTACTT
AAAGTTGGAAGTCTGAGACTTTAGCATCTTGATGTAATTC
C

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations