Transcript

nr6a1b-202

ID
ZDB-TSCRIPT-091203-260
Name
nr6a1b-202
Previous Names
  • nr6a1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045571 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045571|OTTDARG00000032601|ZDB-GENE-040724-202 nr6a1b|OTTDARP00000035984 nr6a1b-001 LG_ FP085418.6 Danio rerio protein_coding KNOWN, 1317 bp
ATGACGGTGGTGAGCGCTGGTGTCTGATCTGTGGGGATCG
AGCGTCCGGCCTGCACTATGGTATTATTTCCTGCGAGGGC
TGTAAAGGCTTCTTCAAGCGCAGTATCTGCAACAAACGCA
TCTATCGCTGCAACAGAGACAAGAACTGCCAGATGTCCCG
CAAACAGCGCAACCGCTGCCAGTACTGTCGGCTGCAGAAG
TGCCTACAGATGGGCATGAACCGCAAGGCAATCAGAGAAG
ACGGGATGCCAGGAGGAAGGAATAAAATGATTGGACCTGT
ACATATCTCGCTGGAGGAGATTGAACGAATTATGTCTGGC
CAGGAGTTTAAAGAAGGATCGGACCTGTCGGATTCGTGGA
GCCACGGTTACAGTAACCACAGTTCACCCGGCAACAGTCT
CTCTGAGGGCGGCCAGAGCTTATCTTTCTCCAGCAGCCGC
TCTGTGTCCTGTAGAGATGAGTGCATCAGTCCTCAACTAA
CACACACTTTCCTGATGTGTAAATATCCTTTACCGCCTCC
TACTGGCAGCATCCTGAAGACGCAAACACACACACTGACA
GGGCAGATCCTCGCTGATGAAGACCTCACACCTCTCACTA
CACCCATGCTCATTGAGGACGGGTACAGCGTGACTCAGTC
GGAGCTGCTGGCGCTGCTGTGTGGTATCGCAGACGAGCTG
CTGTTTAGACAGATCGTGTGGCTCAAGCGTCTGCCGTTCT
TCACTGATCTCTCCATTAAAGACTGCACTCGTCTGCTGGG
CTCTTCATGGCATCAGCTCATCCTGCTGTCCTCCATCACA
GTGCACAGCGCACAGATACTGGGGGAACTGGCGAACGTCA
CACACCACTACACACCCTCCTCACACACACTGCAACGGTT
TGGTGAGGATGCTATGGAGGTCATGGAAAGCTTAAATTTT
CTCTTCCGTAAGTTTCATCAACTAAACATCAGCAATGAGG
AGTACAGCTGCTTAAAGACCATCACGCTGCTTAATCAAGA
GACGACAGGTTTGTGCAACACGTCAATGCTGAAACAATTA
AGTGAACGTTACTGGACGCTGTGTCGTGAGCTGACAGAAC
GACTTCATCCACAGCGACCCAAACGCTTCTCTGACATCAT
CACCTGCCTTACTGAGATACGCCACACGTCAGGTAAAATG
ATGTCTATTCCCTTGGAGCAGCTCCCACTGCTGTTTAAGG
CAGTACTGTATTCCTGCACAACCAATCAAAACCCATGGCT
ACCCAAAAGCTCCACCTCCAGGACATAAACCACACCTTTA
AATCCTGTTTTTATTACTTTTTCCTTCCCCAAGTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations