Transcript

esrra-202

ID
ZDB-TSCRIPT-091110-958
Name
esrra-202
Previous Names
  • esrra-002
  • ncam1-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043371 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043371|OTTDARG00000021053|ZDB-GENE-990415-68 esrra|OTTDARP00000034385 esrral-002 LG_ BX465841.10 Danio rerio protein_coding KNOWN, 347 bp
AAAAGCGCCTGTGAGCGACTCTCCTCCTCCTGAGGGCAGT
CAGTGACTCATGATGTAACGTTTGTCAGGGGGAAAGTGAA
GTTCAAAGATGCGCACTGCTAACTAAACCACGCGTCTTCA
GGCATGTTTATGGGGCTACAACCCGATTTCTTTGTTTTGA
AAAGCCGGTGAGTCAATGAAAAGCTAATTTTGGGTGCAAG
CTCTTCAGTTGAGACGTTTGGGGGAGGCGCGACGGATCTT
GAATGAGTAAAGGTATCATGTCTTCCAGAGAACGACGCTC
TGACCTGTACATAAAGGCTGAGCCTAGCAGTCCTGAGGGA
GGCGGAGGAGGTGGCGGAGGGAGGACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations