Transcript

smarca4a-201

ID
ZDB-TSCRIPT-091110-767
Name
smarca4a-201
Previous Names
  • ch211-12h2.1-001
  • smarca4-001
  • smarca4a-001
  • ottdart00000021400
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021400 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021400|OTTDARG00000017759|ZDB-GENE-030605-1 smarca4a|OTTDARP00000018023 smarca4-001 LG_ BX322663.8 Danio rerio protein_coding KNOWN, 5680 bp
GAGCAGACGGGAGGGGGAAGTGAGAGGGAAAAGGAACTCG
CTGAAGCTGCCCTTTGTTTCTAGATTTGCCGAAGAGAACG
GGGAAGAGACCGGCGCCGATATACACTGCTTTCTGAGAAT
CCAGAACACTGTGTTTCTGCCTCTCACTTCTGGCTCTGCT
GAGAGATGTCCACTCCTGACCCACCCATGGGCGGGACCCC
TCGGCCGGGACCTTCCCCAGGCCCTGGGCCGTCTCCTGGG
GCCATGTTAGGGCCTAGTCCTGGACCCTCACCTGGCTCTG
CCCATGGCATGATGGGCCCCAGCCCTGGGCCCCCCTCTTC
GGGACACCCTCTACCTCCACAGGGCCCCTCAGGTTACCCG
CAGGACAACATGCACCAGATGCACAAGCCCATGGAGGGCA
TGCATGAGAAAGGCATTCCTGAAGACCAGCGCTATGGTCA
GATGAAAGGAATGGGCATGAGGCAGGGTGGGCACAGCGGT
ATGGGACCCCCACCCAGCCCTATGGACCAACATTCTCAAG
GTTACCCATCTCCTCTGGGTGGTTCGGATCACGCCCCCAG
CCCGGTACCTGCTAATGGCCCACCATCTGGCCCCATGATG
CCCTCTGGTCCTGGTGCTATGCCTATGGAAGGCGGAGACC
CGCAGGCAATGGCTCAACAGAACCGGAGTGGAGGTGCAGG
TGGTGTTGCAGGGCCAGGACCCAGCGGAGGACCTCCAAAC
GCAGGTGGCCCTGGTGGTGCTGGCGGACCCACTCCTTTCA
ACCAAAACCAACTTCATCAGCTGCGGGCACAGATCATGGC
CTATAAAATGCTTGCTCGCGGGCAGCCTTTACCAGATCAC
CTACAGATGGCAGTGCAGGGAAAGCGACCCATGCCCGGCA
TGCAGCAGGGGATGCCCAACATGCCCCCTGCTTCAGGACA
AGGAGCAGGACCTCCTGGACCTGGGGTTCCCGGTCCTGGT
GGACCCAACTACAATAGACCACATGGAATGGTTGGACCAA
ACATGCCTCCTCCAGGACCCTCTGGTGTACCTCCAGGCCT
GCAAGGACAACCCACCAATGGACCACCTAAACCTTGGCCT
GAAGGACCCATGGTGAACGCTGCTGCCCCCGCAAGTGCCC
CACAGAAGCTGATACCCCCTCAGCCCACAGGCCGCCCTTC
TCCAGCACCACCGTCAGTTCCTCCCGCTGCCTCCCCTGTC
ATGCCCCCTCAGACCCAGTCTCCAGGTCAGCCAGCCCAGC
CACCGATGGTGCTGCACCAGAAACAGAACCGCATCACACC
CATCCAGAAACCCCGGGGTCTAGACCCGGTGGAGATCCTC
CAGGAAAGAGAGTACAGGTTACAGGCACGTATTGCGCATC
GTATTCAGGAACTGGAGAATCTTCCAGGCTCTCTGGCTGG
AGACTTGAGGACCAAAGCCAACATTGAGCTCAAGGCACTT
AGACTTCTGAACTTTCAGAGACAGCTCCGTCAGGAAGTGG
TAGTGTGTATGCGGCGTGATACGGCCCTGGAGACTGCACT
CAACGCCAAGGCCTACAAGCGAAGTAAGAGACAGTCCCTG
CGCGAGGCTCGTATCACTGAGAAACTGGAGAAACAGCAGA
AGATCGAGCAGGAACGCAAACGCAGACAGAAACACCAGGA
GTATCTCAACAGTATCCTGCAGCATGCAAAGGACTTCAAG
GAATATCATCGTTCCATCACCGCAAAGATGCAGAAGTTGA
CCAAAGCCGTAGCCACGTACCACGCCAACACTGAGCGAGA
GCAGAAGAAGGAGAATGAGCGTATCGAGAAGGAGAGAATG
AGAAGGCTTATGGCTGAAGATGAAGAGGGTTACAGGAAGC
TGATCGATCAAAAGAAGGACAAACGTTTGGCGTACCTGCT
GCAGCAGACCGATGAGTATGTGGCCAATCTCACAGAGCTT
GTCAGAGCTCACAAAGCAGCTCAGGCCCTCAAAGACAAGA
AGAAGAAGAAGAAAAAGAAGAAGCCAGAGAACGCTGAAGG
TGGAGCTCCTGCGCTTGGTCCTGATGGAGAGCCTCTGGAT
GAGACTAGTCAAATGAGTGACCTGCCGGTGAAGGTGATTC
ACGTGGACAGTGGGAAGATCCTCACTGGCATGGACGCTCC
TAAAGCTGGACAACTGGATACTTGGCTGGAGATGAATCCA
GGGTACGAGGTGGCCCCGCGCTCAGACAGTGAAGATAGTG
GCTCAGATGAGGAAGAGGATGATGAGGAAGAGCCTCAGCC
CTCTCAGGCCCCGACAGAGGAGAAGAAGGTGATTCCTGAT
CCAGACAGCGAGGATGTTTCTGAGGTTGATGCTCGTCACA
TTATTGAACATGCCAAGCAAGATGTAGACGATGAATACGG
GAACTCTGCATTCATTCGGGGCCTGCAGTCATATTATGCT
GTGGCCCACGCCGTCACAGAGAAGGTGGAAAAGCAATCGA
GTCTGCTAGTGAACGGGCAGCTCAAACAATATCAGATTAA
AGGTCTGGAGTGGCTGGTGTCTCTGTATAACAATAACCTA
AATGGCATTCTGGCTGATGAAATGGGTTTGGGCAAAACTA
TCCAGACCATCGCACTCATCACCTACCTCATGGAGTTCAA
ACGCCTCAACGGACCCTTCCTTATCATCGTCCCCCTCTCG
ACTCTGTCGAACTGGGTGTACGAGTTTGATAAGTGGGCTC
CATCTGTGGTGAAAGTTTCTTACAAGGGCTCTCCTGCTGC
TCGCCGTGCGTTCCTTCCCATTTTGCGCAGTGGCAAATTC
AACGTACTGGTCACTACTTATGAATACATCATCAAAGATA
AGCAAGTGCTGGCCAAGCTCCGTTGGAAGTACATGATCGT
GGATGAAGGTCACCGCATGAAAAATCACCACTGTAAACTG
ACTCAGGTATTAAATACGCACTACCTGGCACCCCGGCGTG
TGCTGCTAACTGGCACTCCACTGCAAAACAAGCTGCCCGA
GCTGTGGGCGCTGCTCAACTTCCTGCTGCCCACCATCTTC
AAGAGCTGCAGCACCTTTGAGCAGTGGTTCAACGCGCCCT
TCGCCATGACTGGAGAGAAGGTGGACCTAAATGAAGAAGA
AACCATCCTGATCATCCGTCGTCTGCACAAAGTGCTTCGG
CCCTTCCTGCTCAGGAGACTTAAGAAGGAAGTAGAGGCGC
AGCTACCAGAGAAGGTGGAATATGTGATCAAGTGCGACAT
GTCGGCTCTTCAAAGAGTGCTGTACAGGCACATGCAGGCT
AAAGGAGTGCTGCTCACTGACGGCTCTGAGAAAGACAAGA
AGGGCAAAGGGGGCACTAAGACACTGATGAACACTATTAT
GCAGCTGAGGAAGATCTGTAACCACCCGTACATGTTTCAG
CACATTGAGGAATCTTTCTCTGAGCACCTGGGCTTCACTG
GAGGCATCGTTCAGGGGTCTGATTTGTACCGTGCCTCTGG
TAAATTTGAGCTGCTGGACCGCATTCTGCCAAAGCTCCGC
GCCACCAACCACAAAGTGCTGCTCTTTTGTCAGATGACCA
CACTCATGACCATCATGGAGGACTACTTTGCTTACCGCAA
CTTCAAATACCTCCGCTTAGACGGAACCACTAAGGCTGAG
GATCGTGGCATGTTGCTGAAGAACTTTAACGATCCTTCCC
ATCAGTACTTCATTTTCCTGCTGAGCACCAGAGCAGGGGG
TTTGGGGCTGAACCTGCAGTCTGCCGACACTGTCATCATC
TTTGACAGCGACTGGAACCCTCACCAGGATCTACAGGCTC
AGGATCGAGCCCATCGCATCGGGCAGCAGAATGAGGTGCG
TGTGCTGCGTCTGTGCACTGTGAACAGTGTGGAAGAAAAG
ATCTTGGCTGCTGCCAAATACAAACTCAATGTGGACCAGA
AGGTCATCCAAGCCGGTATGTTCGACCAGAAGTCCTCCAG
CCACGAGCGCAGAGCTTTCCTGCAGGCCATCCTGGAGCAC
GAAGAGCAGGATGAGGAGGAAGATGAAGTACCTGATGATG
AAACTGTTAATCAGATGATCGCCAGAAGCGAGGAAGAGTT
CGACCACTTTATGCGCATGGATCTGGACAGGCGACGTGAG
GAGGCTCGTAACCCGAAGCGCAGGCCGAGGCTGATGGAGG
AAGATGAGCTGCCCACCTGGATCATGAAGGACGATGCTGA
GGTGGAGAGGCTCACCTGTGAAGAGGAAGAGGAGAAGATG
TTCGGCCGTGGCTCCCGCCAGAGGAAGGAGGTGGATTACA
GTGACTCTCTGACAGAGAAACAGTGGCTGAAGGCCATCGA
GGAAGGCACCCTGGATGAGATTGAGGAGGAAGTGCGCCAC
AAGAAAACAACCCGGAAGAGGAAACGTGACCGAGATCTTG
ACCTTCCCGGTCCGGCCACACCTAGCTCCAGTGGGCGGAG
CAGAGATAAAGATGACGACGGTAAGAAGCAGAAGAAACGC
GGCCGCCCTCCTGCTGAGAAACTCTCACCCAATCCTCCAT
CACTAACCAAGAAGATGAAGAAGACTGTGGACGCAGTGAT
CAAATACAAGGATGGCAATGGGAGGCAACTGAGCGAGGTG
TTCATTCAACTGCCGTCTCGTAAAGAGCTGCCCGAGTATT
ATGAACTTATCCGCAAACCTGTGGACTTCAGGAAGATCAA
GGAGCGCATCAGGAGTCACAAGTACCGCAGTCTGAATGAC
CTAGAGAAGGACGTTATGCTGCTGTGTCAGAACGCTCAGA
CCTTCAACCTGGAGGGATCTTTGATCTACGAGGACTCTAT
CGTGCTGCAGTCTGTGTTCACCAGCGTGCGGCAGAAGATC
GAGAAAGAGGAGGAAGAGAGTGAGGGAGATGACAGCGAGG
AGGAAGAGGATGATGTCGATGAAGGATCCGAGTCTGAATC
TCGTTCAGTGAAGGTGAAGATAAAGTTGAGTAGAAAGGAC
AAGGCGGAGAGAGGAAAAGGACGACGCCGAACCGGACGCA
GCTCGCGGCCTAAACCTGTTGTTAGTGATGACGACAGTGA
GGAAGACCAGGAAGAGGAGCATTCGGCTAGTGGCAGCGAG
GAAGATTAAAAACCTCCTTCGAGATGCCTCAGGACCAATC
CCGTCTCTCTGCTGCAAAAACGTCATTTTACTTCAGATTC
AGCACGCCTGCATTTCAGGGGCCTAGTTTTATCCTAGAAC
AGCACATTTTTAGAGACATGACAAGTATACGAAACGATTA
AATGAGAAAATGACACTATATAAAATGCAGAGAGAAAAAT
GGCCCCTTCCATTTGCATATTTAAGCAGACGAAATCTTTA
TGTATAGCAGGACAGTTTAAGCGTTGAGCATTTGGTGTTA
CTTTCCACGTTTGTTTTTATGATTTTTGATTTCTCAAGGA
TGTGACATAAGATGGACAGATATCTGACAGACCAGACTCA
GTGGACCAGTAAGAATGGATCATGTTTCATTGTCCTCTTA
TTGTTTTTAGCTGTGTGAACGTCACCCCCTTTATCCCCCT
ACACACCCCAGAATGCATGCTATTTGTGGTAAACGCAGCC
AGTTATTTCTCTTTCCGTTTTTCCTCTGTTTAAATTTAGA
TTGCAAACAGGATTAAGGTACTTCTAGTCAGGAGGAATGG
GGGAGAATAGGGTGTAGGATTCTGTACTGTGTCAGTGTCA
CTGGATTTACAAAATGCACAATAAAGGCATCTCAGAATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations