Transcript

klf6a-202

ID
ZDB-TSCRIPT-091110-455
Name
klf6a-202
Previous Names
  • copeb-001
  • klf6a-001
  • ch73-36i7.1-001
  • ch73-73n3.1-002
  • ottdart00000044218
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044218 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044218|OTTDARG00000031739|ZDB-GENE-021115-9 klf6a|OTTDARP00000035010 CH73-36I7.1-001 LG_ CU462914.19 Danio rerio protein_coding NOVEL, 3369 bp
GGCTGCGAGGTTTGAACAGGGGAAGTTGACAGAGCGCAGC
GCTGTGCGTGAGTTCAGTGTTTGCAAATATAGAGAGATCT
CAACAGACGGACTAGCGGACTCCGAGCAAAGCGACGGCTG
CACCGCGTTGCTATTGCACGAAGAGGACGCTTGCTTTGTT
TGCTCGTCACACTTTATCTTGATTCAGCAAGATACATCTA
TCTATTTTTTTGGTCTTGATACTCGGGATTGCAATGGATG
TTCTACCAATGTGCAGCATTTTTCAGGAACTTCAGATCGT
CCACGACACTGGCTATTTCTCTGCATTGCCATCGCTTGAA
GAATACTGGCAACAGACATGTTTGGAGCTGGAGAGATATT
TGCAGAGCGAGCCTTACGTCTCTGCGTCTGACCTCAAGTT
TGAGGGCCAGGAGGATCTTTGGAGCAAGCTCATCTTGGCT
TGTGGAGATAAGGGCGATGGGAACGGCAGCCTTCCCAGCG
TCAAGGAGGACGACAATCAGGACTGCCAAATATTGGAAAC
CAACAGCATGAATTCGGATGCCAGCAGCGAGGCGTCTGAC
AGCTCGGAGGAGCTCTCTCCCACTCACATCTTTACCTCCA
ACCCGCTGGGCTCAGTTCTGACGGAGTCAGCACATCACTT
GAGTTCCTCTATCATCAGCACACCTCCGTCCTCCCCAGAA
ATGCCCCAAGAGCCTGGCGTCCCGCAGGTGTGGGGCTCCA
CACAGACTGACTTGCACATCCCAGTGAAGATCAGGCAAAA
CGGGCTGGGGAAGGCCTTGGATAAGACTACCACTGGAGGG
GACGCGTCTCCAGACGGCAGGAGGAGAGTGCACAGGTGTC
ATTTCAACGGCTGCCGGAAGGTTTACACAAAAAGTTCTCA
CTTAAAAGCACATCAGCGGACTCACACAGGTGAGAAGCCG
TACAGGTGTTCATGGGAAGGCTGCGAGTGGCGCTTTGCAA
GGAGCGATGAGCTAACCCGACACTTCAGGAAGCACACTGG
TGCAAAGCCATTTAAATGCAGTCACTGTGACAGTTTCTTT
CTCCAGGTGTTTCTCTAGGTCGGACCACCTGGCCCTGCAC
ATGAAGAGGCACCTCTGAGCGGGCCGTAGCTTCACGCTGG
GGATGTGTTGTGTCCTGACCAGCTTCCTGGTTGACCTGGC
CCTGCAAAGAAATAGGGGGAGCGTGTTCCAGCCAAAGCAT
GCCATTTTGCACCATATCCTGTGCCTCCGTGAGCCCCGGG
ATAAAGGCGGACTGACTGGTTGTTGAAATGAACAAAATCA
AAAAAGGAAGGGACAAAATCACGAATGAAGAATGGAAGAC
AGGATGATTTATTTTAAAAAACATGTAAAACAAAAAACAA
AAAACAGAGCGAGTGAATGGTGTGTTGTATGGTGCATGAT
GAACTCCTGGACTATACACTGGTACTTTTTAAATCGAATC
CTAACGAAAGCCTGTTTGACGTGAGCGGATGAATGTCCCG
TCTGCGGAGAAGGGTGGGAGGGGGGTACCAGTGTATCGCT
GTGGGCTGAATGGTGTCGGGAAACAAGTTCCGTTTTTGTT
TCCACATGGTATGCAAGGAAGCCGTGAGACTGAGGACTCC
TGCCAGACGCCCCTGGGCTCTGTGTCGCAAGAATTCCAAG
GGGGGGCCCCCAAGCGGCCAGGGTTTCACCCCATTTAAAA
AGGGGGAGGCGGAAACTCGGTCCTGAATGAAAGTGGCTTT
TTTGGTGTTCGGTGCAGCTACTAAATGTGCAATGTGTTCG
GTAGCTTGTTATTTTGACAGGCTACAAAAGCTCATTTGTA
GTCCGTTGTATAAGCTGTGTGCTTAGAAGATGTAACACAA
TTATAACTTCACTATCATAAACAGGTGTTGCATGGTATTG
GGGTTTGTTTCTTTTTCTTTTCTTTTTCTTTTTGTAATTG
GGACTGCAAATAGATTCCAATAAAGCGCAGCTAAATACAA
TTGGTTAAATGTTACAATATTGTACATAAACGCATTGATC
ATCCTTCACCCTAAATTCCCACCCCATTTCTTTCCAATGA
GGGGGGACCACTTGATACATACAAGACTTGTACTCGTTTC
ATCTTGAGGACTAAATTCGCTCTTTCTATCTCCATTTGAC
CTGTTGTTAATGCACTGTTGACCTTAATGGTGCCTTATGC
AAGTGACCTTTCCATTTGGGTGGTCGCAAAATGTCTTTTA
AAAACAAAACAAGCTTTATTAAGGCTCTGTTTCACCTGAT
TGTGCACCTTGTCCCGTTTTTGAGGCCACTGTAAGCAAGC
CCTTGTAGATACGTAATATATTGTGGTTCGTGAGCATGCC
ATTATCATTCTTTTACCCTCACATTTCTCAACTCTGCAAT
GTAGAGCACTTAGGGGTTTGGTATCTACCGAGCGACCTTT
TTGAATACGCTTTGGACGCAAGATCTTTATCTGTGTAGGT
GTGTGTGTGTAAGCTCTTAAAGTGCAAAAACAGGCTGTTG
TATAACACAAGGCTTGTGGAATGCCAACCCCCCCCCCTTC
TGACCCCCATCCCCTGTAACCAAGAATGAAGAAAAAAAGC
CTAAAGATTTATTGTAATTAACAAGCTCCAGTCAGACAGG
CCTTGCCTTGTACTGCCTCTCTGTAATGAATTGCTGAAGG
CCCTGCCTGCTACAGACTGCTGACTCTGGCAGTTCGATAT
TGACCTGTCTGGATGCCGTTGTTTTAGTCCAGCGACAGTA
TTGTGGAAACAGTGCACAGCCATCCAGAAAGATAAAGATA
TATCGCTTCTCTCTTCAACATTTTACAATGGAAGTCGAAC
AGCGCATCTGCTTGGCTGTGTGCGTTTCTTTTGCAATCTG
AATGGTAAACTCTAATGTTTTCAGGGACCAAACGATTGAC
TTAAAGTTATTGTACATAGTTGTATGCTTGAATTATTTGC
GCTTTTTTTTTTAGCGCCGACGGAGGTTTGACACTGTTGC
ATGTCGAGCAGCTACGTGGAAACGGATTGTTTGAAAAGTA
ACTTGAAGCAGCTTCTGTGCTGCCATTTTAATCAGACCAG
CCAGGGTTTTGTGGGCAAAGAACATTGTCTTTCCAACAGT
GGCCGATATTAGTCAAGTGGTAATGGAGCCTTAATCAAGT
TTCTCATTTGCTTGCTTCAACCAACACTTTCTATCACGTA
TCTTTTCTCTCATGAACCCCTCTTGTCTAGAGAATATTTG
TACAAAAGAATAAAAACCAGAAAAGTTAGAAAAAAAAAAA
AAACATTTTCTAAGATTTTTATTTGTTTTTGCTTTATATG
AATTTTATTTGAAATTGTTTTGCAAAATTGTTATATTTCT
GTATGAATGTATTTTTTATTGGAATAATAAGAAATTCTTA
TCGGAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations