Transcript

rnf14-202

ID
ZDB-TSCRIPT-091110-1889
Name
rnf14-202
Previous Names
  • rnf14-002
  • ch211-266d19.3-001
  • ottdart00000044147
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044147 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044147|OTTDARG00000031687|ZDB-GENE-040625-65 rnf14|OTTDARP00000034960 rnf14-002 LG_none CU459117.6,CU459208.9 Danio rerio protein_coding KNOWN, 961 bp
AATGACAATACGTAACAGCTTTCTTTGGTATGATGAAATG
TCGATAGAGTATTCAGTATTTTATATCTTATACAGTATTT
AAAGACCATTTTATTCTCCTGTGGCACTGATATTTTAGTG
AGACTTTCGTCTCTTTAACACACGAGTAACGCTAGACGGT
GAATATTGAGAGTGAAACTTCAAGCGTTGTTGTTTTGACA
GCAGGTTCTAACTAGAGGTTTGCTAACTTGGGAATGTTCA
AATGTCAGCTGACCAGGAAGCAAAAGAAGATGAACTGCTT
GCTCTAGCGAGCATATATGATGAAGAGGAGTTTCACAGAG
CAGAATCAGGAAAGGAAGGCGAGATTCATCTGTGCTTAGA
GCTTCCACCTAACTTCAAGCTGCTAGTCAAGGGACAGAAA
TCTGCAGAGCATAATATATCATTTCTGCCTCCCTTGGTTC
TGAGTTTTGACCTCCCTGACGACTACCCTTCTACATCTGC
ACCCATTTTTACTATCAGCTCCAAATGGCTCACAAGAGTT
CAGATCACTGCGCTTTGCAGGAAGCTGGATGAGCTTTGGG
AGGAGAACCAAGGCAATGTGGTTCTTTTTACATGGATCCA
GTTCCTAAAGGAAGAGACTCTGGACTTTTTGGGGATTCAA
TCTCCTCTGGAAATCCAAAGAAGTGGCAGCCAGCCTCAGT
GTGAACCCGCACAGAAACACGCAGCAGATGCTTCCGGAGA
AAAAAGCAAAGTGCAGGATCTAGACCCAAGAGCCGTTCAG
GAAGTTGACGCTCAGACAGATATACTGACTCAGCTGCTGG
ATTTTGACGAAGCCCAGAAGCAAAGGGTGTTTGACGGGAA
GGCGTTTTGCTGCGGCATCTGCTACTCCGAGAAGCTGGGA
TGCGACTGTTTGCTCTTCAAAGAGTGTGAGCATGTTTACT
GCAAGGCCTGCATTAAAGAATACTTTCAGATCCAGATTAA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations