Transcript

esrrgb-201

ID
ZDB-TSCRIPT-090929-947
Name
esrrgb-201
Previous Names
  • esrrgb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007327 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007327|OTTDARG00000006635|ZDB-GENE-040616-4 esrrgb|OTTDARP00000006515 esrrgb-001 LG_ BX004824.10 Danio rerio protein_coding KNOWN, 1825 bp
AGCGGCTTCACTGCAGCAGCAGAAACGCGAAGAACAGAGA
CAGACGACCTTAATTACCATAAAACATCATTACACAAGAA
AACGAGCCAGAGATTTACAGTTTTTCTTGATTTCACAGGA
GTTTTCTGAGGTTATGGTTTTATTCTCGACGGTCTAATGG
ATCTAGTGCAGTTTTATCACCCGGAATCCTTTTCCTTCCC
TTCTGAACAGAACGCCTTCATGGACATGATGTCATTCAGC
GGACACTGTCCCCCTTATATTAAGACCGAACCGTCCAGTC
CGTCCTCACTGTCAGATAGTCTGACCCAGCACAGTCCCGG
AGCCTCATCAGACGCCGGGAGCAGCTACAGTTCAGGACCT
AAAGGAAACCTGGCAGGCCTGGACTCTCCGGCATCGTACC
TGCGCAGTGCCCCCTGCAGGCTTCTGGAGGAAGCGCAGGC
GAAGGGTGAATACGGGCTGAGCTCAGGCCCCAAACGTCTG
TGTCTGGTGTGTGGAGATGTTGCGTCTGGATTCCACTACG
GGGTGGCTTCATGTGAGGCCTGCAAAGCATTTTTCAAACG
CACCATCCAAGGTAACATAGAGTACAGTTGTTCAGTCAGC
AGAGACTGTGAGATCACTAAACGCAGGAGGAAGTCCTGTC
AGGCCTGTCGCTTCACCAAGTGTCTGTCTGTGGGGATGCT
GAGAGAAGGTGTGCGTTTGGACCGGGTTCGAGGAGGACGG
CAGAAATATAAGAGGAGAATTGACTCCGATTCTAGTGTTT
ACCTCAGTGTGCCACTTCCTCACAGAAAACCAGTGTCCTG
CAGCGCTCATGCTGAAAATAAGGTGGTGACGCTTCTGCTG
GGGGCGGAGCCAGAGAAGGTGTGTGCCATGCCTGACCCCG
CCCTCCCCGATAGTGACATCAAAGCCCTGACGACCCTGTG
TGACCTCGCTGACCGAGAGCTGGTGCTGAATATCAGCTGG
GCCAAACACATACCAGGTTTCTCCAGCCTCTCACTGTCGG
ATCAGATGAGTCTCCTACAGAGCGCCTGGATGGAGATTCT
GGTCCTGCGGGTGGCGTTTCGCTCTCTGCCCTGCGACGAC
AGGCTGCTGTTTGCGGACGATTACATCATGGATGCGGAAC
AGGCCAAATGTGCCGGTCTGCTGGAGCTGCACACGGCCAT
ATTACAGCTGGTGCGCAGATACAGATGCATGAGTCTGGAG
AGAGAAGAGTTCGTCACTCTGAAGGCCATCGCTCTCGCTA
ACTCAGACTCGATGCACATTGAGGACGTGGAGGCGGTTCA
GGGTCTTCAGGACGCCCTGCACGAGGCTCTGCTGGATTAC
GAGTGTGTGCATCACAGTGAGGACCCTCGACGGGCAGGAA
AACTCATCATGACTCTCCCGCTGCTCCGCCAAACCTCCGC
TAAAGCCGTTCGTCATTTCTGCAGCATCAAACAGGACGGA
CGCGTCCCAATGCACAAACTCTTCCTGGAGCTGCTGGAGG
CCAACATCTGATCCGCAAGCCCATTGGACTGTCAGACTGA
GGTGACACTCCCCCTCTCGCACACCATTGGCTGAGGGAGG
ATTGGTCACAGATACAGGGGAAATTACTTATTAACAATAA
CACAGGATATACTCCATACGGATACAGTTGGTCAAAATGA
TTCGCCTCCTGTTCATTTTTTGTGTTTTCTTTTTAAAATA
TTTACCAAATGCTGTTTAACGGAGGAGGGAATTTTTCACA
GTATTTCCTATTATATATTTTTTTTTCTGGAGAAAGTCTG
ATTTGTTTTATTTCGGCTAGAGTAAAAGCAGTTTTTAATT
TTATAAAGTGAAGTTTATTTATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations