Transcript

smc4-002

ID
ZDB-TSCRIPT-090929-8643
Name
smc4-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025943 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025943|OTTDARG00000020669|ZDB-GENE-020419-21 smc4|no_translation smc4-002 LG_ CR478286.10 Danio rerio protein_coding KNOWN, 766 bp
CAAATTTGGCTCAGATGGCCAAATCATGGCTGAAATTGCA
CAGTGTTAGCAGAATGTTACACATCAGCATGACTAACCTA
TGCTAACCGATGCTTTTACAGAGCCTCACAGAGCAGGAGC
TTCACCTCAAGCCTCAGATCAAGGACCTGGAGGCAAACGT
GATCGCCGCTGCTCCTGATAAAGCCAAGCAGAAGCAGATG
GAGAAGAGTCTGGAGGCCTACAGGAAAGACTTTGAGGCAG
CGTCCAATAAAGCAGGAAAGGTGGAGGCCGAGGTGAAGCG
GCTGCACACGCTCATCGTGGACATCAACAGTCACAAGCTG
AAGGCGCAGCAGGACAAACTGGACCAGATCAACACGCAGC
TTGACCAGTGCTCCTCAGCCGTCACCAAAGCCCAGGTGGC
CATCAAGACTGCGGGACGTAATCTGAAGAAATCAGAGGAC
GGTGTGAGTCGGCTGGAGCAGGAGATCAGTGAGAATGAGA
AGCTGATGGAGGAGCTGACGGAGCAGCTGAAGAAACTGGA
GGAGCAGGCTGGAGAAATCATGCAGTCCTACCAGCAGGCG
GAGGAGGCTCTGCCCGAGGTGCAGGATCAGCATCGTGCAG
TGGTGCAGGAGATCAAGGCTCTACAGGAGCAGGAGCACGC
GCTGCAGAAAGAGTCTCTGAGCGTCCGGCTGAAGGTGGAG
CACATCGACACAGCCATCACAGAGTGCCACAACAAGATCA
AACACTGGCAGAAAGAGGCCAGCAAGTTGTGTCTTCACCA
CATTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations