Transcript

slc8a1a-202

ID
ZDB-TSCRIPT-090929-8287
Name
slc8a1a-202
Previous Names
  • slc8a1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025557 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025557|OTTDARG00000020437|ZDB-GENE-050809-1 slc8a1a|OTTDARP00000021013 slc8a1a-001 LG_none CR848823.5,CR556713.11 Danio rerio protein_coding KNOWN, 3647 bp
GCCAGAGACAATGCCTGTTTCTGTTAAATTTAGACAGTTT
ATCGGCCAACGCTCCTCCGCATAGACAGTCTCTCGCTGCA
CCGCTGGGAATACAGAGGGTACTGGAGAGCAGGAACAAAA
TACCTCACTGGGAACATGGGCCAATCTGGGACTTCATCCT
ATTTTTCTCTCGCTCTAAATCTCAGCATCTTCCTCTTAGT
TTTCTCCTATGAGCTCACGCCAGTCATTGCAGGCAGCTCC
AAATCGAGCTTAGATGTAGATACTTCCAATGCAAACTCTT
CTCAAGAGACATGTGGTGGTAGTTATGAATGCAAAGAGGG
GGTGATCTTGCCAATTTGGACACCGGTGAACCCGTCCTTT
GGGGATAAGTTGGCCAGAGCCACTGTGTACTTTGTCGGTT
TGTTCTACATGTTCCTAGGAGTATCCATCATTGCAGACCG
CTTCATGGCTTCCATTGAGGTCATCACATCCCAGGAGAAA
GAGATCACCATTAAGAAGCCCAACGGAGAAACCACAACTA
CTACAGTTCGTATTTGGAATGAAACGGTCTCAAATCTGAC
TCTCATGGCTTTGGGTTCTTCAGCCCCAGAGATTCTGCTG
TCCGTGGTTGAAGTGTGTGGGCACAACTTTGACGCAGGAG
AGCTGGGCCCAAACACCATTGTGGGAAGTGCAGCTTTTAA
CATGTTTGTCATCATCGGTCTCTGTGTCTCTGTGATACCC
GAAGGAGAGCACCGGAAGGTCAAGCACCTGCGGGTCTTCT
TTGTCACCGCCACTTGGAGTATCTTTGCATATACGTGGCT
TTACCTGATTTTGGCAGTGATTTCCCCAGGTATCGTGGAG
GTCTGGGAGGGACTTCTTACTCTGTTTTTCTTTCCTATTT
GTGTATTATTTGCTTGGGTTGCAGACCGTAGACTTCTGTT
TTACAAATACGTGTATAAACGTTACAGAGTTGGAAAGAAA
CGTGGGATAATTATAGAGACTGAAGGTGAACCAGAACTCC
AGTCAAAGGCTGATATCGAAATGGATGGCGGGATGCTTAA
CTCTCATGCCGAGGAGTTTTTAGACGGCGCAGTTGATAAT
GAAGATAAAGACGCGGATGAGGACGAGGCCAGAAGGGAAA
TGGCCAAGATTTTGAAGGAACTGAAACAGAAGCATCCGGA
AAAGGAGATGGAGCAGCTTGTTGAGCTTGCCAACTACCAC
GTCCTCAGCCAGCAACAGAAGAGCCGTGCTTTCTATCGCT
GTCAGGCCACTAGACTTATGACTGGTGCAGGAAATATACT
GAAGAAACATGCTGCAGATCAAGCCAGAAAAGCACTTGGT
ATCCATGAACTTCGATCGGAAGTCTCCGATAATGATATCT
CCTCCAAGATTTTCTTCGACCCTGGGACATATCAGTGTTT
GGAGAACTGTGGAACTGTGGCTTTGAACGTGGTTCGACGC
GGCGGCGACTTAACCAGCACTGTGTCAGTGGAGTACAGAA
CTGAGGATGGCACTGCCAATGCAGGTTCTGATTACCAGTT
CACTGAGGGTGTCATAATCTTCAAACCAGGTGAGACCGAA
AAGGAGATTAGAGTGGACATTATCGACGATGATATATTTG
AAGAAGATGAACACTTCCTGGTTCATCTCAGCAATGTCAA
GGTCATATCTGAAGGAGCCAACAATGGAAACCCAGGTACC
AATCATGTGGACGCTTTAGCTGGTCTTGGCCTTCCTTCAA
CAGCTACCGTGACTATCTTTGATGATGACCATGCTGGCAT
CTTCTTATTTGAGGAACCAATTGTTCATATCAGTGAAAGC
ATTGGCATGATGGAGGTGAAGGTGGTACGTACATCTGGAG
CCCGTGGAGTAGTGGTAATCCCCTATAAAACCATCGAAGG
CACAGCCAAAGGTGGAGGAGAGGACTTTGAAGACACCCAT
GGAGTCTTGGAGTTCCAGAATGATGAGATTTCCAAGACTA
TTCAGATCAATATAATCGATGACGAGGAGTATGAAAAGAA
TAAGAACTTCTTCCTGGAGATTGGAGAGCCACAATTGGTG
GAAATGAGTGAAAGAAAAGCTATGTTGCTGCATGAATGTG
GTGGATTCGTGAAGACAGGCAGGGATGTGTACCGGAAAGT
GCAGGGTAGAGACAAACCAATCCCCTCCACCATTATCAGC
ATCTCAGAGGACGGGGAGGAAGAGACCCTGACTAAAAAAG
AGAAAGATGAGAGGCGTATTGCTGAAATGGGTCGTCCGAC
CCTGGGTGAACACGTGAAACTTGAAGTAATCATTGAAGAG
TCTTATGAATTCAAGAGCACCGTCGACAAACTCATAAAGA
AAACCAACTTGGCCCTTCTGGTGGGTACCAACAGTTGGAG
AGACCAGTTTGTTGAAGCCATCACTGTCAACTCAGGGGAC
GATGATGATGAAGAGTGTGGCCAAGAAAAGATGCCGTCCT
GCTTTGACTACGTCATGCACTTCCTCACGGTATTCTGGAA
GGTTCTGTTTGCATTTGTGCCCCCTACTGACTACTGGAAC
GGCTGGGCTTGTTTCATCGTGTCCATCATGATGATTGGCG
TCCTCACCGCCTTCATCGGGGATATAGCTTCTCATTTCGG
GTGCACTATTGGCCTGAAAGACTCTGTGACTGCAGTCGTG
TTTGTGGCACTGGGAACGTCTGTGCCAGACACATTTGCCA
GTAAAGTGGCAGCGATCCAGGATCAGTACGCGGACGCCTC
CATCGGCAACGTGACAGGCAGCAATGCAGTGAACGTGTTT
TTGGGCATCGGAGTGGCCTGGTCTATTGCTGCCATCTTCC
ACCAGTCTCAGGGGCGGCAGTTTCGCGTGGACCCCGGGAC
GCTGGCCTTCTCTGTCACACTCTTCACCATCTTTGCCTTC
GTCTGCATCGCCGTCCTCATGTACCGCCGCAGGCCTGAGA
TCGGCGGAGAACTGGGCGGCCCGCGCCATCCCAAAATAAT
TACCACTACACTGTTTTTCAGTCTCTGGTTGATGTACATC
ATACTGTCCTCAATGGAGGCTTATTGCATCATCAAGGGTT
TCTAAAATGATGCCACAGATGCGGGACGGTGTCTTTAAGA
CTCTTGTGAACAGGTGGAAAAGGTTCAGAAGAGGAGCTCA
GAGCAGCCGTGGAGGACTGCCTGCTGTTTCTTGAACATCC
ACTGTATGTTTTATGTGTGTGAATGCCCAGCTAACAAGGA
TTATTCTCTGAACGTTCTGGCGAGGTTCTCTTTAAGTTAT
TAGTGAATGAACCATTTTTTTCATTATTTCCTCTAATTAT
TAGTTGTAGTTTAGCTGGATTGAGGCAAAAAAATGTACAG
AGTGATTCAACATAGGCTAATTCTGAAAACGTAGCCCTAT
ATACATTTTTGGAGATTGCAATTTATGTAGCCAGAGCTAT
GTATGGCTGCAATTTATCTTTAAAATGAATGCTGTGGGGC
GGTATGACACCGTTCCTTTGTACGCTTACCAGCTGACTGC
TTACCTCCAAGTGGATGACTTTTCTGCTGTTACCAGTTTG
TCCGGTAGCTCGACATGTATGTTGGCGGACTTGAGATGCA
GTGAGGAGTTGACCACAACAACAGGGTTCGAGTCCGATAA
AGAATAGTTTCAGAAATTGGGTAAGACAAAAACAGAAGCT
AAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations