Transcript

rxrgb-201

ID
ZDB-TSCRIPT-090929-823
Name
rxrgb-201
Previous Names
  • rxrgb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006739 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006739|OTTDARG00000006139|ZDB-GENE-040718-34 rxrgb|OTTDARP00000005998 rxrgb-001 LG_ BX296562.4 Danio rerio protein_coding KNOWN, 1819 bp
AGAGGGGTGCTGCCGCGCGCCTCCAGGACAAGACCTGACT
ATAAACTAACGCGGAATGGATACTCACGACACATATTTAC
ATCTCCACTCTAGTCCTCTTAACTCGTCCCCCTCTCAGCC
GCCGGTCATGAGCTCTATGGTGGGTCATCCGTCCGTCATC
AGCTCCTCTCGCCCCCTGCCGTCCCCCATGAGCACTCTGG
GCTCCTCTATGAATGGCCTGCCCTCACCCTACTCCGTCAT
CACCCCGTCTCTCAGTTCGCCCTCCATTTCCCTGCCCTCC
ACACCCAGCATGGGCTTTAACACCCTCAACAGCCCACAGA
TGAACTCTCTCAGTATGAATGGCAATGAAGACATCAAGCC
CCCGCCAGGATTGGCACCGCTGGGCAACATGAGCAGCTAC
CAGTGCACCAGCCCTGGATCTCTGTCCAAACACATCTGTG
CCATCTGTGGAGACCGATCTTCAGGGAAGCATTATGGTGT
TTATAGTTGTGAAGGCTGCAAGGGCTTCTTTAAGAGGACC
ATTCGAAAAGACCTGACGTACACATGTCGAGACATTAAAG
AGTGCCTGATCGACAAGCGCCAGCGCAACCGCTGCCAATA
CTGCCGCTACCAGAAGTGCTTGGCCATGGGCATGAAGCGC
GAAGCGGTTCAGGAAGAGAGGCAGCGAGGGAAAGAGAAAA
GTGATACTGAGGTGGAAACAACAAGCAGGTTTAATGAAGA
CATGCCTGTGGATAAAATCCTGGATGCAGAACTGTCAGTC
GAACCCAAGACTGAGACGTACACAGAGAGCAGCCCCAGCA
ACTCAACAAATGACCCAGTCACTAATATCTGCCATGCAGC
GGATAAGCAGTTGTTTACTCTGGTGGAGTGGGCCAAGAGA
ATACCTCATTTCTCTGATCTGCCTCTGGATGATCAAGTAA
TCCTTCTTCGAGCAGGATGGAACGAGCTGCTCATTGCTTC
ATTCTCTCATCGCTCCATCACAGTGAAAGATGGCATCCTG
CTAGGCACAGGGCTTCATGTCCACAGGAGCAGTGCTCACA
GTGCAGGAGTTGGCTCCATTTTCAACAGGGTACTGACCGA
ACTGGTGTCTAAAATGAAGGACATGCAGATGGATAAGACA
GAACTAGGCTGCCTTAGGGCCATCGTCCTCTTCAACCCTG
ACGCCAAAGGCTTGTCAAACTCACTGGAGGTGGAGGCACT
GAGGGAGAAGGTTTACGCCTCGCTGGAGACCTACACTAAA
CAGAAATACCCCGACCAGCCTGGCAGGTTTGCTAAGCTGC
TGCTGCGTCTTCCTGCGCTTCGCTCCATCGGCCTCAAGTG
TCTGGAGCACCTGTTTTTCTTTAAGCTGATTGGAGACACA
CCTATAGACACTTTCCTCATGGAGATGCTGGAAGCGCCAC
ATCAGATCACGTGACACCAGCTCTAATGGACCATTTTTTG
TACATATTCTTATGTAACTAATATAATAATGAACCTGATT
GAAGATACTGTAGGATGCTGCATCTTTTATACTGAGCACA
AATTGTTATTTGACAAAATATTGGCAGGGAAAAGACGAAG
AGGAAGTCTCAAAATATATAAGGATAAAATAAATGTTATT
GGTATGGTTCTGAAAAGAAATGTCTCTGTAAATAGGTAAT
GTCCAGGTATCCATTGTGGCAAGACAATGCAAAAATTTAT
ATTTTATTCAAGGAATATGCGTATCAAACCCGAACAGTAA
TTTCTAAAATGAAGTTTAGAATTGTTTGAATAAATATTTA
AATATTTAAATGTTACGTCATCGTTTTTCTTGTGTTTTTT
GAATAAAAAAACGAATGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations